miR-Intess: classification

candidate novel miRNAs

block5195_cand

Cloning frequencies
absolute	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block5195_cand 3arm	0	0	0	0	0	0	0	0	1	1
normalized	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block5195_cand 3arm	0	0	0	0	0	0	0	0	0.000	0.000

block5195 [novel_randfoldOK]

Hairpin parameters
miRNA	randfold	RNA	rep	GC min/max	len min/max/mir_range	5'var	3'var	reads	reads edited	libs	libs edited	base distance	loop distance	position	locations	exon distance	unpaired	max bulge	total reads	total libs	dicer	drosha
no	0.002	no	no	0.70/0.70	20/23/1.00	0.0	1.5	2	0	2	0	10	2	3arm	1	nd	0.20	1	2	2	na	na

		reads	miRBase family seed
seed	-------------------------------------------------GAGCUCC-------------------------	2	novel
		len	cloning frequencies
			T5S1	T5S2
	------------------------------------------------GGAGCTCCCTCGCCTTCAGCTCC----------	23	1	-
	------------------------------------------------GGAGCTCCCTCGCCTTCAGC-------------	20	-	1
rat	ctagatctctagaagctggtggcagggctgctgcctacactccctcagGGAGCTCCCTCGCCTTCAGCTCCcagtggtctg
	*********************************************************************************
	+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++	ENSRNOT00000009283 ENSRNOG00000006873 Dnase1
rat	.((((((.((...((((((.(((((((..(((.(((..........))).))).)))).))).))))))...)).))))))	0.970 -35.00

rat

chromosome:10:11763853:11763933:-1

block6557_cand

Cloning frequencies
absolute	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block6557_cand 3arm	0	0	0	0	0	0	0	0	1	0
normalized	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block6557_cand 3arm	0	0	0	0	0	0	0	0	0.000	0

block6557 [novel_randfoldOK]

Hairpin parameters
miRNA	randfold	RNA	rep	GC min/max	len min/max/mir_range	5'var	3'var	reads	reads edited	libs	libs edited	base distance	loop distance	position	locations	exon distance	unpaired	max bulge	total reads	total libs	dicer	drosha
no	0.010	no	no	0.50/0.50	20/20/1.00	0.0	0.0	1	0	1	0	10	2	3arm	1	nd	0.25	3	1	1	na	na

		reads	miRBase family seed
seed	-------------------------------------------------------------GAACAAC----------------------	1	novel
		len	cloning frequencies
			T5S1
	------------------------------------------------------------AGAACAACCACCTCTCAGGA----------	20	1
rat	ggggaatcctttagcctgtgctgagaagtggctgttttggattgggactggggattggccAGAACAACCACCTCTCAGGAatggccccta
	******************************************************************************************
	++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++	ENSRNOT00000004172 ENSRNOG00000002997 Slc9a3r2
	++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++	ENSRNOT00000043592 ENSRNOG00000002997 Slc9a3r2
	++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++	ENSRNOT00000004066 ENSRNOG00000002997 Slc9a3r2
rat	((((.........(((....((((((.((((.((((((((..................)))))))).)))).))))))....))))))).	0.630 -32.37

rat

chromosome:10:13894917:13895006:-1

Same_strand|Intronic_coding|ENSRNOT00000004172|ENSRNOG00000002997 ## ENSRNOG00000002997|protein_coding|Slc9a3r2|Na(+)/H(+) exchange regulatory cofactor NHE-RF2 (NHERF-2) (Tyrosine kinase activator protein 1) (TKA-1) (SRY-interacting protein 1) (SIP- 1) (Solute carrier family 9 isoform A3 regulatory factor 2) (NHE3 kinase A regulatory protein E3KARP) (Sodium-hydroge [Source:UniProtKB/Swiss-Prot;Acc:Q920G2]

block7720_cand

Cloning frequencies
absolute	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block7720_cand 5arm	0	0	0	0	0	0.500	0	0	0	0
normalized	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block7720_cand 5arm	0	0	0	0	0	0.000	0	0	0	0

block7720 [novel_randfoldOK]

Hairpin parameters
miRNA	randfold	RNA	rep	GC min/max	len min/max/mir_range	5'var	3'var	reads	reads edited	libs	libs edited	base distance	loop distance	position	locations	exon distance	unpaired	max bulge	total reads	total libs	dicer	drosha
no	0.004	no	no	0.75/0.75	20/20/1.00	0.0	0.0	1	0	1	0	19	4	5arm	2	nd	0.10	1	1	1	na	na

Families
Member of family novel226 (seed GCCCCCU): block7720_cand, block7759_cand

		reads	miRBase family seed
seed	--------------------GCCCCCU-----------------------------------------------------------------------	1	novel
		len	cloning frequencies
			T3S2
	-------------------CGCCCCCTGGCGGCTTCATG-----------------------------------------------------------	20	1
rat	GCAACCTGCAACGATCCAGCGCCCCCTGGCGGCTTCATGGGTTTCAGAACCTCTTGGAG-----CGCAGCCAGGGGGCACAGAGGGCGAAGCCAGGGC
human	-------------------CGCCCCCTGGCGGCTTAGAGCG----AGCATCGCTCCGCGACCCACTTAGACGGGGCGTCCCC----------------
mouse	-------------------CGCCCCCTGGCGGCCTCTTGTGTTTCAGGACATCTTTGAG-----CTCAGCCAGGGGGCA-------------------
	************** * * * ** * ** * * * ** * *** *
	++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ +++++++++++++++++++++++++++++++++++++++	ENSRNOT00000048977 ENSRNOG00000031686 LOC360504
rat	....(((((..((.(((...((((((((((.((((((.(((((....)))))..))))) )...)))))))))).....)))))..)).)))..	0.970 -47.90
human	((((((((((.((.((.((((( .....)))))...)).)).)).))..)))))).....	0.980 -22.20
mouse	.((((((((((((.(((..(((((....)))))....))) .)).)))))))))).	0.990 -32.00

rat	chromosome:10:15568523:15568615:-1	Same_strand\|Intronic_non-coding\|ENSRNOT00000048977\|ENSRNOG00000031686 ## ENSRNOG00000031686\|protein_coding\|LOC360504\|hemoglobin alpha 2 chain [Source:RefSeq_peptide;Acc:NP_001007723]
human	chromosome:19:45726957:45727015:-1	Opposite_strand\|Boundary_non-coding\|ENST00000392023\|ENSG00000160460\|protein_coding\|Spectrin beta chain, brain 3 (Spectrin, non-erythroid beta chain 3)(Beta-IV spectrin) [Source:UniProtKB/Swiss-Prot;Acc:Q9H254] ## Opposite_strand\|Intronic_coding\|ENST00000392025\|ENSG00000160460\|protein_coding\|Spectrin beta chain, brain 3 (Spectrin, non-erythroid beta chain 3)(Beta-IV spectrin) [Source:UniProtKB/Swiss-Prot;Acc:Q9H254] ## {SimpF: -1 Eponine}
mouse	chromosome:11:32199999:32200131:1	Same_strand\|Boundary_non-coding\|ENSMUST00000020535\|ENSMUSG00000020295\|protein_coding\|hemoglobin, theta 1 Gene [Source:MGI (curated);Acc:Hbq1-001]

block7759_cand

Cloning frequencies
absolute	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block7759_cand 5arm	0	0	0	0	0	0.500	0	0	0	0
normalized	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block7759_cand 5arm	0	0	0	0	0	0.000	0	0	0	0

block7759 [novel_randfoldOK]

Hairpin parameters
miRNA	randfold	RNA	rep	GC min/max	len min/max/mir_range	5'var	3'var	reads	reads edited	libs	libs edited	base distance	loop distance	position	locations	exon distance	unpaired	max bulge	total reads	total libs	dicer	drosha
no	0.001	no	no	0.75/0.75	20/20/1.00	0.0	0.0	1	0	1	0	8	4	5arm	2	nd	0.10	1	1	1	na	na

Families
Member of family novel226 (seed GCCCCCU): block7720_cand, block7759_cand

		reads	miRBase family seed
seed	---------GCCCCCU----------------------------------------------------------	1	novel
		len	cloning frequencies
			T3S2
	--------CGCCCCCTGGCGGCTTCATG----------------------------------------------	20	1
rat	CGATCCAGCGCCCCCTGGCGGCTTCATGGGTTTCAGAACCTCTTGGAG--CGCAGCCAGGGGGCACAGAGGGCG
human	--------CGCCCCCTGGCGGCTTAGAGCG----AGCATCGCTCCGCGACC-CACTTAGACG-------GGGCG
mouse	--------CGCCCCCTGGCGGCGCGCCGGGGCGGAGCGGCCCGCCGCAGCCGCAGCCGGCGG-------AGGCG
	************** * * ** * * * * ** * * ****
rat	((.(((...((((((((((.((((((.(((((....)))))..))))) )...)))))))))).....)))))	1.000 -39.50
human	((((((((((.((.((.((((( .....)))))...)).) ).)).))..) )))))	0.990 -21.60
mouse	(((((((((((((((((.((((.((...)).)))).))).)))...))))).)) .))))	0.939 -36.90

rat	chromosome:10:15582464:15582535:-1	intergenic
human	chromosome:19:45726932:45727043:-1	Opposite_strand\|Boundary_non-coding\|ENST00000392023\|ENSG00000160460\|protein_coding\|Spectrin beta chain, brain 3 (Spectrin, non-erythroid beta chain 3)(Beta-IV spectrin) [Source:UniProtKB/Swiss-Prot;Acc:Q9H254] ## Opposite_strand\|Intronic_coding\|ENST00000392025\|ENSG00000160460\|protein_coding\|Spectrin beta chain, brain 3 (Spectrin, non-erythroid beta chain 3)(Beta-IV spectrin) [Source:UniProtKB/Swiss-Prot;Acc:Q9H254] ## {SimpF: -1 Eponine, -1 Eponine}
mouse	chromosome:11:104303664:104303775:-1	Same_strand\|Boundary_non-coding\|ENSMUST00000106977\|ENSMUSG00000018412\|protein_coding\|RIKEN cDNA 1700081L11 gene Gene [Source:MGI Symbol;Acc:MGI:1923969] ## Same_strand\|Intronic_non-coding\|ENSMUST00000106974\|ENSMUSG00000018412\|protein_coding\|RIKEN cDNA 1700081L11 gene Gene [Source:MGI Symbol;Acc:MGI:1923969] ## {Repeats: dust 0 class=dust,GC_rich -1 class=Low_complexity,trf 0 class=trf} ## {SimpF: oe = 0.77 1 CpG, -1 Eponine, -1 Eponine, 1 Eponine}

block7786_cand

Cloning frequencies
absolute	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block7786_cand 5arm	0	0	0	0	0	0	0	0	1	0
normalized	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block7786_cand 5arm	0	0	0	0	0	0	0	0	0.000	0

block7786 [novel_randfoldOK]

Hairpin parameters
miRNA	randfold	RNA	rep	GC min/max	len min/max/mir_range	5'var	3'var	reads	reads edited	libs	libs edited	base distance	loop distance	position	locations	exon distance	unpaired	max bulge	total reads	total libs	dicer	drosha
no	0.010	no	no	0.48/0.48	23/23/1.00	0.0	0.0	1	0	1	0	5	4	5arm	1	nd	0.26	3	1	1	na	na

		reads	miRBase family seed
seed	------GCAAGAC--------------------------------------------------------------	1	novel
		len	cloning frequencies
			T5S1
	-----CGCAAGACTGAGTCTATGACAGA-----------------------------------------------	23	1
rat	gcataCGCAAGACTGAGTCTATGACAGAagccccatcctttggcctctctctaggcatgtctctgcagacatgca
	***************************************************************************
rat	((((..(((((((...(((((.((.(((.(((.........))).))).)))))))..)))).)))....)))).	0.950 -23.20

rat

chromosome:10:15590292:15590366:-1

intergenic

block8539_cand

Cloning frequencies
absolute	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block8539_cand 5arm	0	0	0	0	0	1	0	0	0	0
normalized	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block8539_cand 5arm	0	0	0	0	0	0.000	0	0	0	0

block8539 [novel_randfoldOK]

Hairpin parameters
miRNA	randfold	RNA	rep	GC min/max	len min/max/mir_range	5'var	3'var	reads	reads edited	libs	libs edited	base distance	loop distance	position	locations	exon distance	unpaired	max bulge	total reads	total libs	dicer	drosha
no	0.003	no	no	0.59/0.59	22/22/1.00	0.0	0.0	1	0	1	0	16	2	5arm	1	nd	0.18	3	1	1	na	na

		reads	miRBase family seed
seed	-----------------GGUACUC---------------------------------------------------------------------	1	novel
		len	cloning frequencies
			T3S2
	----------------GGGTACTCCCAAGGTTCCTGGT-------------------------------------------------------	22	1
rat	ctgctggggaccgaaaGGGTACTCCCAAGGTTCCTGGTgggagtatctgagactgcctggagccttgtgtgaccatgttcgtttcttggtagc
	*********************************************************************************************
rat	((((..((((.((((..(((((...(((((((((.(((((............))))).))))))))).))).))...)))).))))..)))).	1.000 -41.50

rat

chromosome:10:16871039:16871131:-1

intergenic

block8667_cand

Cloning frequencies
absolute	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block8667_cand 3arm	0	0	0.500	0	0	0	0	0	0	0
normalized	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block8667_cand 3arm	0	0	0.000	0	0	0	0	0	0	0

block8667 [novel_randfoldOK]

Hairpin parameters
miRNA	randfold	RNA	rep	GC min/max	len min/max/mir_range	5'var	3'var	reads	reads edited	libs	libs edited	base distance	loop distance	position	locations	exon distance	unpaired	max bulge	total reads	total libs	dicer	drosha
no	0.010	no	no	0.50/0.50	20/20/1.00	0.0	0.0	1	0	1	0	19	8	3arm	2	nd	0.20	2	1	1	na	na

Families
Member of family novel211 (seed GUCUGUG): block8667_cand, block2348771_cand

		reads	miRBase family seed
seed	------------------------------------------------------------------GUCUGUG-------------------------------	1	novel
		len	cloning frequencies
			T2S1
	-----------------------------------------------------------------TGTCTGTGTCTGGCTTGTCT-------------------	20	1
rat	ctgtctggtgggaggatagagtaagatgttaagatcacagagggtgaatagaggctccttgacctTGTCTGTGTCTGGCTTGTCTccctcctgctctcagacag
	********************************************************************************************************
rat	(((((((..((.((((..(((((((......(((.((((((((((.....(((....))).))))..)))))))))..)))).)))..)))).))..)))))))	1.000 -40.60

rat

chromosome:10:17105384:17105487:-1

intergenic

block15863_cand

Cloning frequencies
absolute	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block15863_cand 3arm	0	1	0	0	0	0	0	0	0	0
normalized	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block15863_cand 3arm	0	0.000	0	0	0	0	0	0	0	0

block15863 [novel_randfoldOK]

Hairpin parameters
miRNA	randfold	RNA	rep	GC min/max	len min/max/mir_range	5'var	3'var	reads	reads edited	libs	libs edited	base distance	loop distance	position	locations	exon distance	unpaired	max bulge	total reads	total libs	dicer	drosha
no	0.004	no	no	0.65/0.65	20/20/1.00	0.0	0.0	1	0	1	0	12	14	3arm	1	nd	0.05	1	1	1	na	na

Families
Member of family novel164 (seed GGCCCUG): block15863_cand, block1439122_cand

		reads	miRBase family seed
seed	----------------------------------------------------------------------------GGCCCUG------------------------	1	novel
		len	cloning frequencies
			T1S2
	---------------------------------------------------------------------------AGGCCCTGAGGACCCTGAGT------------	20	1
rat	GCAGAAAAAAACGCACAGGGTTATGCAGCTGTTCTCGGGGCTTCCAGAGAGTCAGTTAACGGCTACCTCTATAACAGGCCCTGAGGACCCTGAGTGTCAGAGCTGCG
mouse	------------GCACAGGGTTTTGCAGCTGTTCTCGGGGCTTCCGGGGAGTCCGTTAACGGCTACCTCTCTAACAGGCCCTGAGAACCCTGAG------------G
	******** ******************** * *** ************ ********** ****** *
rat	((((......((((.(((((((...........((((((((((....((((..(((.....)))..)))).....))))))))))))))))).)))).....)))).	0.670 -43.90
mouse	...((((((...........(((((((((((..((((((.(((....)))....))))))...))))))))))))))))).. .	0.798 -36.90

rat	chromosome:10:36521342:36521448:-1	intergenic
mouse	chromosome:11:50757190:50757336:-1	Same_strand\|Boundary_non-coding\|ENSMUST00000101256\|ENSMUSG00000072983\|protein_coding\|RIKEN cDNA 4933414I15 gene Gene [Source:MGI Symbol;Acc:MGI:1918374]

block17727_cand

Cloning frequencies
absolute	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block17727_cand 5arm	0	0	0	0	0	0.500	0	0	0	0
normalized	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block17727_cand 5arm	0	0	0	0	0	0.000	0	0	0	0

block17727 [novel_randfoldOK]

Hairpin parameters
miRNA	randfold	RNA	rep	GC min/max	len min/max/mir_range	5'var	3'var	reads	reads edited	libs	libs edited	base distance	loop distance	position	locations	exon distance	unpaired	max bulge	total reads	total libs	dicer	drosha
no	0.003	no	no	0.62/0.62	21/21/1.00	0.0	0.0	1	0	1	0	17	8	5arm	2	nd	0.29	2	1	1	na	na

Families
Member of family novel214 (seed CAUGGAC): block17727_cand, block983268_cand

		reads	miRBase family seed
seed	------------------CAUGGAC----------------------------------------------------------------------	1	novel
		len	cloning frequencies
			T3S2
	-----------------CCATGGACGCTGTGGCAGCTT---------------------------------------------------------	21	1
rat	cttccagtgttcacttaCCATGGACGCTGTGGCAGCTTccaacagcagcctgctgcctggctgcctcagtgaccagccctcagtaacattctgag
	***********************************************************************************************
rat	(((..((((((.(((.....(((.(((((.(((((((.....((((.....))))...))))))).))))).)))......)))))))))..)))	0.840 -36.40

rat

chromosome:10:40117304:40117398:-1

intergenic

block19975_cand

Cloning frequencies
absolute	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block19975_cand 5arm	0	0	0	0	0	0	0	0	1	0
normalized	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block19975_cand 5arm	0	0	0	0	0	0	0	0	0.000	0

block19975 [novel_randfoldOK]

Hairpin parameters
miRNA	randfold	RNA	rep	GC min/max	len min/max/mir_range	5'var	3'var	reads	reads edited	libs	libs edited	base distance	loop distance	position	locations	exon distance	unpaired	max bulge	total reads	total libs	dicer	drosha
no	0.008	no	no	0.65/0.65	20/20/1.00	0.0	0.0	1	0	1	0	25	1	5arm	1	nd	0.25	2	1	1	na	na

Families
Member of family novel92 (seed GGCCUUG): block19975_cand, block747878_cand

		reads	miRBase family seed
seed	--------------------------GGCCUUG------------------------------------------------------------------------	1	novel
		len	cloning frequencies
			T5S1
	-------------------------TGGCCTTGTGGTGGCTCTCC------------------------------------------------------------	20	1
rat	CGACCAGCAGGGCCTCACTTGCCCTTGGCCTTGTGGTGGCTCTCCGTCTTCTTGGGCAGCAACACCGCCTGGATGTTGGGCAGGACGCCGCCCTGCGCGATGGTC
human	-------------------------TGGCCTTGTGGTGGCTCTCCGTCTTCTTGGGCAGCAGTACGGCCT-----------------------------------
mouse	----------------------CCTTGGCCTTGTGGTGGCTCTCGGTCTTCTTCGGCAGCAGTACGGCCTGG---------------------------------
	***************** **** *** ****
	-------------------------------------------------------------------------------------------------------------------	ENSRNOT00000033866 ENSRNOG00000022983 Trim17
	-------------------------------------------------------------------------------------------------------------------	ENSRNOT00000048642 ENSRNOG00000022983 Trim17
	-------------------------------------------------------------------------------------------------------------------	ENSRNOT00000033894 ENSRNOG00000022983 Trim17
	-------------------------------------------------------------------------------------------------------------------	ENSRNOT00000058453 ENSRNOG00000022983 Trim17
rat	.((((((((((((....(((((((....((..(((((((((.((((......)))).)))..))))))..)).....))))))).....)))))))....)))))	1.000 -51.80
human	.((((..(((.((.((.((((......)))).)))).))))))).	1.000 -16.00
mouse	((..((((..(((.((.((.((((......)))).)))).))))))).))	1.000 -16.10

rat	chromosome:10:45246207:45246311:-1	Opposite_strand\|Intronic_coding\|ENSRNOT00000058453\|ENSRNOG00000022983 ## Opposite_strand\|Boundary_non-coding\|ENSRNOT00000003885\|ENSRNOG00000022983 ## ENSRNOG00000022983\|protein_coding\|Trim17\|Tripartite motif-containing protein 17 (Testis RING finger protein). [Source:UniProtKB/Swiss-Prot;Acc:Q9WV59] ## {SimpF: oe = 0.70 -1 CpG}
human	chromosome:1:226711715:226711859:1	Opposite_strand\|Exonic_non-coding\|ENST00000366695\|ENSG00000181218\|protein_coding\|Histone H2A type 3 [Source:UniProtKB/Swiss-Prot;Acc:Q7L7L0] ## {SimpF: rank = 2 -1 FirstEF,rank = 3 -1 FirstEF,oe = 0.82 0 CpG,rank = 1 -1 FirstEF}
mouse	chromosome:13:21878703:21878752:1	Opposite_strand\|Exonic_coding\|ENSMUST00000091751\|ENSMUSG00000069309\|protein_coding\|histone cluster 1, H2an Gene [Source:MGI (curated);Acc:Hist1h2an-001] ## {SimpF: oe = 0.78 1 CpG}