candidate novel miRNAs
block1795620_cand
| absolute | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block1795620_cand 5arm | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 |
| normalized | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block1795620_cand 5arm | 0 | 0 | 0 | 0 | 0 | 0.000 | 0 | 0 | 0 | 0 |
block1795620 [novel_randfoldOK]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| no | 0.001 | no | no | 0.64/0.64 | 22/22/1.00 | 0.0 | 0.0 | 1 | 0 | 1 | 0 | 25 | 4 | 5arm | 1 | nd | 0.23 | 2 | 1 | 1 | na | na |
| Located in cluster 60: block1795608_cand, block1795620_cand |
| Member of family novel31 (seed GGGUCCU): block1795608_cand, block1795608_cand, block1795620_cand |
| reads | miRBase family seed | ||
| seed | --------------------------GGGUCCU---------------------------------------------------------------------------- | 1 | novel |
| len | cloning frequencies | ||
| T3S2 | |||
| -------------------------CGGGTCCTTCAGGAGTCATGCC-------------------------------------------------------------- | 22 | 1 | |
| rat | agcatggtaggtccctgtggggcccCGGGTCCTTCAGGAGTCATGCCgggtaatgagaagcatggtaggtccctgtggggccctgggtccttcaggagtcatgccgggt | ||
| ************************************************************************************************************* | |||
| +++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ | ENSRNOT00000023143 ENSRNOG00000017037 RGD1560468_predicted | ||
| rat | .((.(((((((..((((.(((((((.((((((..((((..((.(((((.((........)).)))))))..))))..)))))).))))))).))))..)).))))).)) | 1.000 -59.10 |
| rat | chromosome:5:157735295:157735403:-1 | Same_strand|Intronic_coding|ENSRNOT00000023143|ENSRNOG00000017037 ## ENSRNOG00000017037|protein_coding|RGD1560468_predicted| ## {Repeats: trf 582 604 0 class=trf} |
block1884888_cand
| absolute | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block1884888_cand 5arm | 0.667 | 0.667 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| normalized | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block1884888_cand 5arm | 0.000 | 0.000 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
block1884888 [novel_randfoldOK]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| no | 0.004 | no | no | 0.59/0.78 | 18/23/0.75 | 0.0 0.3 | 0.0 0.0 | 1 3 | 0 0 | 1 2 | 0 0 | 25 30 | 11 1 | 5arm 5arm | 3 3 | nd nd | 0.17 0.14 | 1 2 | 4 | 2 | na | na |
| Located in cluster 62: block1884888_cand, block1884889_cand, block1884890_cand |
| Member of family novel16 (seed AGCCCCA): block205126_cand, block313902_cand, block1884890_cand, block1884888_cand, block1884889_cand |
| reads | miRBase family seed | |||
| seed | --------------------------------GCCCCAA---------------------------------------------------------------------------- | 2 | novel | |
| seed | -------------------------------AGCCCCA----------------------------------------------------------------------------- | 1 | novel | |
| seed | --------------------------CCCCCAG---------------------------------------------------------------------------------- | 1 | novel | |
| len | cloning frequencies | |||
| T1S1 | T1S2 | |||
| -------------------------------AGCCCCAACGCCTTTGCTCTCT-------------------------------------------------------------- | 22 | - | 2 | |
| ------------------------------CAGCCCCAACGCCTTTGCTCTCT-------------------------------------------------------------- | 23 | 1 | - | |
| -------------------------TCCCCCAGCCCCAACGCC------------------------------------------------------------------------ | 18 | 1 | - | |
| rat | AGGCCTCACCACCGCTGACTTCCTATCCCCCAGCCCCAACGCCTTTGCTCTCTGATCTAATGCCAGAGAGGAGGGGTTGGGGCAGGGGCTCCAACCTCACCACCGCTGACTTCCT | |||
| mouse | ------------TGCTGACTTCCTATCCCCCAGCCCCGACGCCTTTCCTCTCTGATCTAATGCCAGAGAGGAGGGGTTGGGGCGGGGG--------------------------- | |||
| ************************ ******** ************************************ **** | ||||
| rat | (((..(((.......(((.........((((.((((((((.((((..(((((((.........))))))))))).)))))))).))))........))).......)))...))) | 0.550 -43.07 | ||
| mouse | ..............(((((.((((((..((((((((((((((.........))))))))))))))))))))))))) | 0.997 -45.80 | ||
| rat | chromosome:5:149060083:149060197:1 | intergenic ## {Repeats: trf 220 248 0 class=trf} |
| mouse | chromosome:4:129713845:129713920:1 | intergenic |
block1884889_cand
| absolute | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block1884889_cand 3arm | 0.667 | 0.667 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| normalized | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block1884889_cand 3arm | 0.000 | 0.000 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
block1884889 [novel_randfoldOK]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| no | 0.002 | no | no | 0.59/0.78 | 18/23/0.75 | 0.0 0.3 | 0.0 0.0 | 1 3 | 0 0 | 1 2 | 0 0 | 27 17 | 10 15 | 3arm 3arm | 3 3 | nd nd | 0.17 0.14 | 1 2 | 4 | 2 | na | na |
| Located in cluster 62: block1884888_cand, block1884889_cand, block1884890_cand |
| Member of family novel16 (seed AGCCCCA): block205126_cand, block313902_cand, block1884890_cand, block1884888_cand, block1884889_cand |
| reads | miRBase family seed | |||
| seed | -----------------------------------------------------------------------------GCCCCAA------------------------------- | 2 | novel | |
| seed | -----------------------------------------------------------------------CCCCCAG------------------------------------- | 1 | novel | |
| seed | ----------------------------------------------------------------------------AGCCCCA-------------------------------- | 1 | novel | |
| len | cloning frequencies | |||
| T1S1 | T1S2 | |||
| ----------------------------------------------------------------------------AGCCCCAACGCCTTTGCTCTCT----------------- | 22 | - | 2 | |
| ----------------------------------------------------------------------TCCCCCAGCCCCAACGCC--------------------------- | 18 | 1 | - | |
| ---------------------------------------------------------------------------CAGCCCCAACGCCTTTGCTCTCT----------------- | 23 | 1 | - | |
| rat | gctctctgatctaatgccagagaggaggggttggggcaggggctccaacctcaccaccgctgacttcctaTCCCCCAGCCCCAACGCCTTTGCTCTCTgatctaatgccagagag | |||
| ******************************************************************************************************************* | ||||
| rat | .(((((((.........(((((((((((.((((((((.((((........(((.......))).........)))).)))))))).))))..))))))).........))))))) | 0.990 -50.40 | ||
| rat | chromosome:5:149060129:149060243:1 | intergenic ## {Repeats: trf 129 157 0 class=trf} |
novel_lenNOK_cloningOK_randfoldOK (112 loci)
block24962_cand
| absolute | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block24962_cand 3arm | 5 | 0 | 5 | 0 | 0 | 1 | 0 | 0 | 1 | 1 |
| normalized | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block24962_cand 3arm | 0.000 | 0 | 0.000 | 0 | 0 | 0.000 | 0 | 0 | 0.000 | 0.000 |
block24962 [novel_lenNOK_cloningOK_randfoldOK]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| no | 0.010 | no | no | 0.83/0.83 | 18/18/0.00 | 0.0 | 0.0 | 10 | 0 | 5 | 0 | 5 | 25 | 3arm | 1 | 59 | 0.11 | 1 | 13 | 5 | na | na |
| Member of family novel8 (seed GGGGUGG): block24962_cand, block60051_cand, block518725_cand, block868622_cand, block940345_cand, block978353_cand, block1198539_cand, block2260096_cand, block2312308_cand |
| reads | miRBase family seed | ||||||
| seed | --------------------------------------------------------------------------------------------------GGGGUGG--------------- | 13 | novel | ||||
| len | cloning frequencies | ||||||
| T1S1 | T2S1 | T3S2 | T5S1 | T5S2 | |||
| -------------------------------------------------------------------------------------------------TGGGGTGGGGGGGGGTCC----- | 18 | 5 | 5 | 1 | 1 | 1 | |
| rat | ctagaggaggcattgcccgcccttgaagaagccatgcgggtaccagaggctggcactagatggtgccaggagtggggatggggccagccttttgaccTGGGGTGGGGGGGGGTCCtctgg | ||||||
| ************************************************************************************************************************ | |||||||
| >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ | ENSRNOT00000045220 ENSRNOG00000021356 DLP2 | ||||||
| >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ | ENSRNOT00000029496 ENSRNOG00000021356 DLP2 | ||||||
| >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ | ENSRNOT00000031194 ENSRNOG00000021356 DLP2 | ||||||
| >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ | ENSRNOT00000047939 ENSRNOG00000021356 DLP2 | ||||||
| >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ | ENSRNOT00000048270 ENSRNOG00000021356 DLP2 | ||||||
| >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ | ENSRNOT00000045432 ENSRNOG00000021356 DLP2 | ||||||
| rat | (((((((.......((((.(((((......(((...(((((...((((((((((.(((.......(((....)))...))).))))))))))..))))).)))))))).))))))))))) | 0.760 -53.31 | |||||
| rat | chromosome:10:56244077:56244196:-1 | Same_strand|Intronic_coding|ENSRNOT00000045432|ENSRNOG00000021356 ## ENSRNOG00000021356|protein_coding|DLP2|Dynein axonemal heavy chain-like protein (Fragment). [Source:UniProtKB/TrEMBL;Acc:Q2KML4] ## {Repeats: dust 56244082 56244099 0 class=dust} |
block50103_cand
| absolute | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block50103_cand 3arm | 1 | 2 | 0 | 1 | 1 | 2 | 0 | 1 | 0 | 2 |
| normalized | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block50103_cand 3arm | 0.000 | 0.000 | 0 | 0.000 | 0.000 | 0.000 | 0 | 0.000 | 0 | 0.000 |
block50103 [novel_lenNOK_cloningOK_randfoldOK]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| no | 0.007 | no | no | 0.67/0.67 | 18/18/0.00 | 0.0 | 0.0 | 10 | 0 | 7 | 0 | 9 | 27 | 3arm | 1 | nd | 0.22 | 3 | 10 | 7 | na | na |
| reads | miRBase family seed | ||||||||
| seed | -----------------------------------------------------------------------------------------CAGGGGU------------------- | 10 | novel | ||||||
| len | cloning frequencies | ||||||||
| T1S1 | T1S2 | T2S2 | T3S1 | T3S2 | T4S2 | T5S2 | |||
| ----------------------------------------------------------------------------------------GCAGGGGTGGTTCAGTGG--------- | 18 | 1 | 2 | 1 | 1 | 2 | 1 | 2 | |
| rat | gctgggccagcatagttgaggttcccctgggctctgatcctgctggggccagcatagttaaggttccccagggtgcagggagcagggtGCAGGGGTGGTTCAGTGGcaggcctgc | ||||||||
| ******************************************************************************************************************* | |||||||||
| +++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ | ENSRNOT00000004718 ENSRNOG00000003464 RGD1311422_predicted | ||||||||
| rat | ((.(((((.((...((((((...((((((.((((((.(((((((((((((...........))..)))))....))))))..)))))).))))))...)))))).)).))))))) | 0.970 -55.30 | |||||||
| rat | chromosome:10:105437065:105437179:-1 | Same_strand|Intronic_coding|ENSRNOT00000004718|ENSRNOG00000003464 ## ENSRNOG00000003464|protein_coding|RGD1311422_predicted| ## {Repeats: trf 1 7 0 class=trf} |
block84799_cand
| absolute | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block84799_cand 3arm | 0 | 0 | 8 | 0 | 0 | 0 | 2 | 0 | 4 | 0 |
| normalized | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block84799_cand 3arm | 0 | 0 | 0.000 | 0 | 0 | 0 | 0.000 | 0 | 0.000 | 0 |
block84799 [novel_lenNOK_cloningOK_randfoldOK]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| no | 0.001 | no | no | 0.67/0.68 | 18/19/0.00 | 0.0 | 0.0 | 11 | 0 | 3 | 0 | 10 | 30 | 3arm | 1 | nd | 0.11 | 2 | 14 | 3 | na | na |
| reads | miRBase family seed | ||||
| seed | ----------------------------------------------------------------------------------------AGCCAGG-------------------- | 13 | novel | ||
| seed | ---------------------------------------------------------------------------------------AAGCCAG--------------------- | 1 | novel | ||
| len | cloning frequencies | ||||
| T2S1 | T4S1 | T5S1 | |||
| ---------------------------------------------------------------------------------------AAGCCAGGGGTTGAGCCC---------- | 18 | 8 | 2 | 3 | |
| --------------------------------------------------------------------------------------GAAGCCAGGGGTTGAGCCC---------- | 19 | - | - | 1 | |
| rat | ggaacaggctgggtctcaacccgctggtctcctcaggctaagggagctcccagccgactgatgatgagtcctgaatggcagtgtaggAAGCCAGGGGTTGAGCCCagctcgtgcc | ||||
| ******************************************************************************************************************* | |||||
| ----------------------------------------------------------------------------------------------------------------------------- | ENSRNOT00000004609 ENSRNOG00000003276 Myo1d | ||||
| rat | ((.((..((((((.((((((((.((((..((((((.((((.((((.(((.(((....))).....)))))))...))))..)).))))..))))))))))))))))))..)).)) | 0.570 -60.60 | |||
| rat | chromosome:10:68724217:68724331:1 | Opposite_strand|Boundary_non-coding|ENSRNOT00000044178|ENSRNOG00000003276 ## Opposite_strand|Intronic_coding|ENSRNOT00000004609|ENSRNOG00000003276 ## ENSRNOG00000003276|protein_coding|Myo1d|Myosin-Id (Myosin heavy chain myr 4). [Source:UniProtKB/Swiss-Prot;Acc:Q63357] |
block89547_cand
| absolute | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block89547_cand 5arm | 6 | 3 | 1 | 2 | 0 | 0 | 0 | 0 | 0 | 0 |
| normalized | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block89547_cand 5arm | 0.000 | 0.000 | 0.000 | 0.000 | 0 | 0 | 0 | 0 | 0 | 0 |
block89547 [novel_lenNOK_cloningOK_randfoldOK]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| no | 0.003 | no | no | 0.50/0.53 | 18/19/0.00 | 0.0 | 0.0 | 11 | 0 | 4 | 0 | 8 | 12 | 5arm | 1 | nd | 0.05 | 1 | 12 | 4 | na | na |
| Member of family miR-299 (seed GGUUUAC): rno-mir-299, rno-mir-299, block89547_cand |
| reads | miRBase family seed | |||||
| seed | ---------GGUUUAC------------------------------------------------------------------------------ | 12 | miR-299 | |||
| len | cloning frequencies | |||||
| T1S1 | T1S2 | T2S1 | T2S2 | |||
| --------TGGTTTACCGTCCCATACC------------------------------------------------------------------- | 19 | 6 | 3 | - | 2 | |
| --------TGGTTTACCGTCCCATAC-------------------------------------------------------------------- | 18 | - | - | 1 | - | |
| rat | gacgtcagTGGTTTACCGTCCCATACCtcttcccatgtctacaccgacatttgagatgtatggaacaaaggaacggtggaagaaccaccagtca | |||||
| ********************************************************************************************** | ||||||
| rat | (((....(((((((((((((((((((.((((...(((((......)))))..)))).)))))).......)).))))....)))))))..))). | 0.890 -30.71 | ||||
| rat | chromosome:10:78133357:78133450:1 | intergenic |
block151455_cand
| absolute | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block151455_cand 5arm | 4 | 2 | 1 | 0 | 0 | 1 | 0 | 2 | 2 | 2 |
| normalized | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block151455_cand 5arm | 0.000 | 0.000 | 0.000 | 0 | 0 | 0.000 | 0 | 0.000 | 0.000 | 0.000 |
block151455 [novel_lenNOK_cloningOK_randfoldOK]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| no | 0.003 | no | no | 0.53/0.56 | 18/19/0.00 | 0.0 | 0.2 | 14 | 0 | 7 | 0 | 16 | 13 | 5arm | 1 | nd | 0.11 | 1 | 14 | 7 | na | na |
| reads | miRBase family seed | ||||||||
| seed | -----------------AACACCA------------------------------------------------------------------------------------- | 14 | novel | ||||||
| len | cloning frequencies | ||||||||
| T1S1 | T1S2 | T2S1 | T3S2 | T4S2 | T5S1 | T5S2 | |||
| ----------------TAACACCACCCAGGGCTA--------------------------------------------------------------------------- | 18 | 3 | 2 | - | 1 | 1 | 2 | 2 | |
| ----------------TAACACCACCCAGGGCTAT-------------------------------------------------------------------------- | 19 | 1 | - | 1 | - | 1 | - | - | |
| rat | tcttttgggattgcacTAACACCACCCAGGGCTATtggaccatgctgcagtttcttccagcagcttctccagagttcatttggagtcagtgttaggcactcatggaaga | ||||||||
| ************************************************************************************************************* | |||||||||
| ----------------------------------------------------------------------------------------------------------------------- | ENSRNOT00000050073 ENSRNOG00000001575 Grik1 | ||||||||
| ----------------------------------------------------------------------------------------------------------------------- | ENSRNOT00000046043 ENSRNOG00000001575 Grik1 | ||||||||
| ----------------------------------------------------------------------------------------------------------------------- | ENSRNOT00000042581 ENSRNOG00000001575 Grik1 | ||||||||
| ----------------------------------------------------------------------------------------------------------------------- | ENSRNOT00000051060 ENSRNOG00000001575 Grik1 | ||||||||
| rat | ((((((..((.(((.(((((((.((((((((((.(((((....(((((...........)))))...))))))))))...))).))..)))))))))).))..)))))) | 0.840 -38.00 | |||||||
| rat | chromosome:11:28037256:28037364:1 | Opposite_strand|Intronic_coding|ENSRNOT00000051060|ENSRNOG00000001575 ## Opposite_strand|Boundary_non-coding|ENSRNOT00000002142|ENSRNOG00000001575 ## ENSRNOG00000001575|protein_coding|Grik1|Glutamate receptor, ionotropic kainate 1 precursor (Glutamate receptor 5) (GluR-5) (GluR5). [Source:UniProtKB/Swiss-Prot;Acc:P22756] |
block230765_cand
| absolute | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block230765_cand 3arm | 6 | 1 | 1 | 3 | 3 | 1 | 6 | 0 | 6 | 2 |
| normalized | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block230765_cand 3arm | 0.000 | 0.000 | 0.000 | 0.000 | 0.000 | 0.000 | 0.000 | 0 | 0.000 | 0.000 |
block230765 [novel_lenNOK_cloningOK_randfoldOK]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| no | 0.002 | no | no | 0.53/0.56 | 18/19/0.00 | 0.0 | 0.0 | 25 | 0 | 9 | 0 | 12 | 5 | 3arm | 1 | nd | 0.22 | 2 | 29 | 9 | na | na |
| reads | miRBase family seed | ||||||||||
| seed | ------------------------------------------------------CAGAGGC---------------------- | 29 | novel | ||||||||
| len | cloning frequencies | ||||||||||
| T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T5S1 | T5S2 | |||
| -----------------------------------------------------GCAGAGGCTATTGTTCCC------------ | 18 | 6 | - | 1 | 3 | 3 | 1 | 6 | 5 | 2 | |
| -----------------------------------------------------GCAGAGGCTATTGTTCCCA----------- | 19 | - | 1 | - | - | - | - | - | 1 | - | |
| rat | gcagaattgccttggtgaattgaaaacggctttcactgtcttcattccaggcaGCAGAGGCTATTGTTCCCaaggtctctgct | ||||||||||
| *********************************************************************************** | |||||||||||
| rat | (((((...(((((((.((((....((..(((((..((((((.......))))))..)))))..))))))))))))).))))). | 1.000 -33.20 | |||||||||
| rat | chromosome:12:38314935:38315017:1 | intergenic |
block253339_cand
| absolute | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block253339_cand 3arm | 3 | 8 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| normalized | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block253339_cand 3arm | 0.000 | 0.000 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
block253339 [novel_lenNOK_cloningOK_randfoldOK]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| no | 0.001 | no | no | 0.33/0.43 | 18/23/0.45 | 0.5 | 2.1 | 11 | 0 | 2 | 0 | 25 | 4 | 3arm | 1 | nd | 0.22 | 3 | 11 | 2 | na | na |
| reads | miRBase family seed | |||
| seed | --------------------------------------------------------------------ACGUGAG---------------------------------------- | 7 | novel | |
| seed | ---------------------------------------------------------------------CGUGAGA--------------------------------------- | 2 | novel | |
| seed | ----------------------------------------------------------------------GUGAGAU-------------------------------------- | 2 | novel | |
| len | cloning frequencies | |||
| T1S1 | T1S2 | |||
| -------------------------------------------------------------------TACGTGAGATAGATTTCAGGTAC------------------------- | 23 | 1 | 3 | |
| -------------------------------------------------------------------TACGTGAGATAGATTTCAG----------------------------- | 19 | 1 | 1 | |
| --------------------------------------------------------------------ACGTGAGATAGATTTCAG----------------------------- | 18 | - | 2 | |
| ---------------------------------------------------------------------CGTGAGATAGATTTCAGGTAC------------------------- | 21 | - | 1 | |
| ---------------------------------------------------------------------CGTGAGATAGATTTCAGGT--------------------------- | 19 | - | 1 | |
| -------------------------------------------------------------------TACGTGAGATAGATTTCA------------------------------ | 18 | 1 | - | |
| rat | gagcgtgtgagagccatggtgagcaagagcacctgaaatccacctaatggagtttaacactaaaaacTACGTGAGATAGATTTCAGGTACtcttgcccaccatattcttagtgct | |||
| ******************************************************************************************************************* | ||||
| +++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ | ENSRNOT00000003527 ENSRNOG00000002595 Dpp10 | |||
| rat | .(((...((((((..((((((.(((((((.((((((((((...((.(((.(((((........))))).))).))...)))))))))).))))))).)))))).))))))..))) | 0.970 -47.50 | ||
| rat | chromosome:13:35717505:35717619:-1 | Same_strand|Intronic_coding|ENSRNOT00000003527|ENSRNOG00000002595 ## ENSRNOG00000002595|protein_coding|Dpp10|Inactive dipeptidyl peptidase 10 (Dipeptidyl peptidase X) (Kv4 potassium channel auxiliary subunit). [Source:UniProtKB/Swiss-Prot;Acc:Q6Q629] |
| Back to summary page | candidate novel miRNAs: | Page 1 | Jump 10 pages back | Previous page | Page 139 | Next page | Jump 10 pages forward | Page 178 |
©2008 InteRNA Genomics B.V.