Small RNA from different tissues of two rat strains.

miR-Intess™

miR classification

Alignments

candidate novel miRNAs

novel_lenNOK_cloningOK_randfoldOK (112 loci)

block690358_cand

Cloning frequencies
absolute	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block690358_cand 5arm	0.310	0	0.286	0	0	0.310	0	0.167	0	0.167
normalized	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block690358_cand 5arm	0.000	0	0.000	0	0	0.000	0	0.000	0	0.000

block690358_cand relative cloning frequencies

block690358 [novel_lenNOK_cloningOK_randfoldOK]

Hairpin parameters
miRNA	randfold	RNA	rep	GC min/max	len min/max/mir_range	5'var	3'var	reads	reads edited	libs	libs edited	base distance	loop distance	position	locations	exon distance	unpaired	max bulge	total reads	total libs	dicer	drosha
no	0.008	no	no	0.39/0.45	18/20/0.12	0.0	0.6	16	0	5	0	9	26	5arm	7	nd	0.15	2	16	5	na	na

Clusters
Located in cluster 35: block690355_cand, block690356_cand, block690357_cand, block690358_cand

Families
Member of family novel10 (seed AGCAGGU): block690355_cand, block690355_cand, block690356_cand, block690356_cand, block690357_cand, block690357_cand, block690358_cand, block690358_cand

block690358 hairpin

		reads	miRBase family seed
seed	------------------------------------------------------------AGCAGGU------------------------------------------------	8	novel
seed	----------AGCAGGU--------------------------------------------------------------------------------------------------	8	novel
		len	cloning frequencies
			T1S1	T2S1	T3S2	T4S2	T5S2
	---------TAGCAGGTAGACTTTAGT----------------------------------------------------------------------------------------	18	1	2	1	-	-
	-----------------------------------------------------------TAGCAGGTAGACTTTAGT--------------------------------------	18	1	2	1	-	-
	---------TAGCAGGTAGACTTTAGTC---------------------------------------------------------------------------------------	19	-	-	1	1	1
	-----------------------------------------------------------TAGCAGGTAGACTTTAGTC-------------------------------------	19	-	-	1	1	1
	---------TAGCAGGTAGACTTTAGTCC--------------------------------------------------------------------------------------	20	1	-	-	-	-
	-----------------------------------------------------------TAGCAGGTAGACTTTAGTCC------------------------------------	20	1	-	-	-	-
rat	TGTTAACTTTAGCAGGTAGACTTTAGTCCTCAGGACTGTATGTATGTCAGTGTTAACTTTAGCAGGTAGACTTTAGTCCTCAGGACTGTATGTATGTCAGTGTTAACTTTAGCAG
mouse	---------AAGCAGGTAGACTTT-------------------------------ACTGAAGCA---AACCTTCAGT-------------TGTAGATCTGTGA------------
	************ * **** * * * ** ***
	+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++	ENSRNOT00000061163 ENSRNOG00000039846
rat	((((((..((((((((((.((..(((((((.(((((((...((.((((..(((((....))))))))).))..))))))).)))))))...)).))))..))))))..)))))).	0.910 -32.20
mouse	..((((((..((... (((((((.. ...))))))) .))..))))))..	1.000 -16.50

rat	chromosome:18:17126380:17126494:-1	Same_strand\|Intronic_coding\|ENSRNOT00000061163\|ENSRNOG00000039846 ## ENSRNOG00000039846\|protein_coding\|\| ## {Repeats: trf 195 215 0 class=trf}
mouse	chromosome:14:116379480:116379634:-1	Opposite_strand\|Boundary_non-coding\|ENSMUST00000088488\|ENSMUSG00000022112\|protein_coding\|glypican 5 Gene [Source:MGI Symbol;Acc:MGI:1194894] ## Opposite_strand\|Intronic_coding\|ENSMUST00000022707\|ENSMUSG00000022112\|protein_coding\|glypican 5 Gene [Source:MGI Symbol;Acc:MGI:1194894]

block1285662_cand

Cloning frequencies
absolute	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block1285662_cand 5arm	0	0	0	0	0	0	0	0	12	1
normalized	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block1285662_cand 5arm	0	0	0	0	0	0	0	0	0.001	0.000

block1285662_cand relative cloning frequencies

block1285662 [novel_lenNOK_cloningOK_randfoldOK]

Hairpin parameters
miRNA	randfold	RNA	rep	GC min/max	len min/max/mir_range	5'var	3'var	reads	reads edited	libs	libs edited	base distance	loop distance	position	locations	exon distance	unpaired	max bulge	total reads	total libs	dicer	drosha
no	0.006	no	no	0.39/0.45	20/25/0.62	0.0 0.0	0.9 0.0	11 1	0 0	2 1	0 0	7 17	24 19	5arm 5arm	1 1	nd nd	0.24 0.35	2 4	13	2	na	na

block1285662 hairpin

		reads	miRBase family seed
seed	--------ACCUUAG-------------------------------------------------------------------------------------------------------	12	novel
seed	------------------GAUUCUU---------------------------------------------------------------------------------------------	1	novel
		len	cloning frequencies
			T5S1	T5S2
	-------AACCTTAGTGTGATTCTTCTCAC----------------------------------------------------------------------------------------	23	6	1
	-------AACCTTAGTGTGATTCTTCTCACTG--------------------------------------------------------------------------------------	25	5	-
	-----------------TGATTCTTCTCACTGCCACA---------------------------------------------------------------------------------	20	1	-
rat	tcatcacAACCTTAGTGTGATTCTTCTCACTGccacactccacttgagctgcttttccgaaagagtaagctggagcccgaacaaggcattgctgaagttgtcgggctctggttgtatg
	**********************************************************************************************************************
rat	.(((.((((((..(((.((((.((((.((.((((....((..(((.((((((((((....))))))).))).)))...))....)))).))..))))..)))).)))..)))))))))	0.480 -39.60

rat

chromosome:2:121197234:121197351:1

intergenic

block1093715_cand

Cloning frequencies
absolute	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block1093715_cand 3arm	1	1	0	0	0	0	0	0	10	0
normalized	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block1093715_cand 3arm	0.000	0.000	0	0	0	0	0	0	0.001	0

block1093715_cand relative cloning frequencies

block1093715 [novel_lenNOK_cloningOK_randfoldOK]

Hairpin parameters
miRNA	randfold	RNA	rep	GC min/max	len min/max/mir_range	5'var	3'var	reads	reads edited	libs	libs edited	base distance	loop distance	position	locations	exon distance	unpaired	max bulge	total reads	total libs	dicer	drosha
no	0.001	no	no	0.37/0.56	18/23/0.57	0.3 0.0	1.3 0.8	6 5	0 0	1 3	0 0	11 3	4 15	3arm 3arm	2 2	nd nd	0.23 0.15	2 2	14	3	na	na

block1093715 hairpin

		reads	miRBase family seed
seed	--------------------------------------------------------------GACUUCA---------------	5	novel
seed	---------------------------------------------------AAAAGCA--------------------------	4	novel
seed	----------------------------------------------------AAAGCAA-------------------------	2	novel
seed	-----------------------------------------------ACCUAAA------------------------------	1	novel
seed	-----------------------------------------------------AAGCAAG------------------------	1	novel
seed	------------------------------------------------------AGCAAGC-----------------------	1	novel
		len	cloning frequencies
			T1S1	T1S2	T5S1
	--------------------------------------------------TAAAAGCAAGCTGACTTCA---------------	19	-	-	4
	-------------------------------------------------------------TGACTTCATCCTGCCCTGAC---	20	-	1	2
	---------------------------------------------------AAAAGCAAGCTGACTTCATCCT-----------	22	-	-	2
	-------------------------------------------------------------TGACTTCATCCTGCCCTG-----	18	1	-	1
	-----------------------------------------------------AAGCAAGCTGACTTCATCCTG----------	21	-	-	1
	----------------------------------------------GACCTAAAAGCAAGCTGACTTCA---------------	23	-	-	1
	----------------------------------------------------AAAGCAAGCTGACTTCATCC------------	20	-	-	1
rat	ggcgggcggggctgggggtagaggacaggctggctccaggtcacaggaccTAAAAGCAAGCTGACTTCATCCTGCCCTGACgcc
	************************************************************************************
rat	((((..((((((..(((((.((((...((((.(((..(((((....)))))...))).))))..))))))))))))))).))))	1.000 -42.80

rat

chromosome:20:5545937:5546020:1

intergenic

block1414072_cand

Cloning frequencies
absolute	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block1414072_cand 3arm	0	1	1	0	0	1	0	0	7	0
normalized	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block1414072_cand 3arm	0	0.000	0.000	0	0	0.000	0	0	0.000	0

block1414072_cand relative cloning frequencies

block1414072 [novel_lenNOK_cloningOK_randfoldOK]

Hairpin parameters
miRNA	randfold	RNA	rep	GC min/max	len min/max/mir_range	5'var	3'var	reads	reads edited	libs	libs edited	base distance	loop distance	position	locations	exon distance	unpaired	max bulge	total reads	total libs	dicer	drosha
no	0.001	no	no	0.33/0.39	18/22/0.20	0.0	0.0	5	0	4	0	11	18	3arm	1	nd	0.05	1	10	4	na	na

block1414072 hairpin

		reads	miRBase family seed
seed	----------------------------------------------------------------------------------------AGCCAUU----------------------	9	novel
seed	--------------------------------------------------------------------------------------UUAGCCA------------------------	1	novel
		len	cloning frequencies
			T1S2	T2S1	T3S2	T5S1
	---------------------------------------------------------------------------------------TAGCCATTCAAATCTCACT-----------	19	-	1	1	5
	---------------------------------------------------------------------------------------TAGCCATTCAAATCTCAC------------	18	-	-	-	1
	---------------------------------------------------------------------------------------TAGCCATTCAAATCTCACTATC--------	22	1	-	-	-
	-------------------------------------------------------------------------------------TTTAGCCATTCAAATCTCACT-----------	21	-	-	-	1
rat	gagacctatgatgaccattacagtgtggtttgggtggctgtctgtattctttctaaaggaactacttcatccttaattgtcatgcttTAGCCATTCAAATCTCACTatcatggcctc
	*********************************************************************************************************************
rat	(((.((.(((((.........((((.((((((((((((((...((((........(((((.........))))).......))))..)))))))))))))).))))))))))).)))	0.970 -36.16

rat

chromosome:3:141688788:141688904:-1

intergenic

block1504822_cand

Cloning frequencies
absolute	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block1504822_cand 5arm	0.667	0.333	0	0	0	0	0.333	0.333	0	0
normalized	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block1504822_cand 5arm	0.000	0.000	0	0	0	0	0.000	0.000	0	0

block1504822_cand relative cloning frequencies

block1504822 [novel_lenNOK_cloningOK_randfoldOK]

Hairpin parameters
miRNA	randfold	RNA	rep	GC min/max	len min/max/mir_range	5'var	3'var	reads	reads edited	libs	libs edited	base distance	loop distance	position	locations	exon distance	unpaired	max bulge	total reads	total libs	dicer	drosha
no	0.005	no	no	0.50/0.50	18/20/0.60	0.0	1.2	10	0	4	0	7	30	5arm	3	nd	0.11	2	10	4	na	na

Families
Member of family novel111 (seed GGUCUGG): block1504822_cand, block1504822_cand

block1504822 hairpin

		reads	miRBase family seed
seed	--------GGUCUGG---------------------------------------------------------------------------------------------------------	5	novel
seed	--------------------------------------------------------------------------------GGUCUGG---------------------------------	5	novel
		len	cloning frequencies
			T1S1	T1S2	T4S1	T4S2
	-------------------------------------------------------------------------------TGGTCTGGTTCACACTTGTG---------------------	20	-	1	1	1
	-------TGGTCTGGTTCACACTTGTG---------------------------------------------------------------------------------------------	20	-	1	1	1
	-------------------------------------------------------------------------------TGGTCTGGTTCACACTTG-----------------------	18	2	-	-	-
	-------TGGTCTGGTTCACACTTG-----------------------------------------------------------------------------------------------	18	2	-	-	-
rat	ggatctgTGGTCTGGTTCACACTTGTGctggaccctggacctgtggtctggttcacacctgtgctgggtcctggatctgTGGTCTGGTTCACACTTGTGctggaccctggacctgtggtc
	************************************************************************************************************************
rat	.((((...((((((((((((((..(((.((((((..(((((...(((((((((((((....)).)))).)).)))))...))))))))))))))..))).))))))..)))))...))))	0.990 -51.60

rat

chromosome:3:148873580:148873699:1

intergenic ## {Repeats: trf 371 391 0 class=trf}

novel_mirtron_randfoldOK (60 loci)

block5868_cand

Cloning frequencies
absolute	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block5868_cand 3arm	0	1	0	0	0	0	0	0	0	0
normalized	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block5868_cand 3arm	0	0.000	0	0	0	0	0	0	0	0

block5868_cand relative cloning frequencies

block5868 [novel_mirtron_randfoldOK]

Hairpin parameters
miRNA	randfold	RNA	rep	GC min/max	len min/max/mir_range	5'var	3'var	reads	reads edited	libs	libs edited	base distance	loop distance	position	locations	exon distance	unpaired	max bulge	total reads	total libs	dicer	drosha
no	0.001	no	no	0.55/0.55	20/20/1.00	0.0	0.0	1	0	1	0	27	6	3arm	1	2	0.30	2	1	1	na	na

block5868 hairpin

		reads	miRBase family seed
seed	------------------------------------------------------------------------GAGGACC----------------------------------------	1	novel
		len	cloning frequencies
			T1S2
	-----------------------------------------------------------------------TGAGGACC-CTGTCTTCCTAC---------------------------	20	1
rat	TGGGTTAAATCCAGGGTGAGGTTTGTGGTAGCTGGGGAGCGTCAAGGTCCAGCAGAAT--GCTGGCTGCTCTGAGGACC-CTGTCTTCCTACAGTTCTTCCTTCGCCCTGGATTCCCAT
human	------------------------GAAGTAGC-----AGC----AGGTCCAGCAGGATGAGCTGATCACCGTGAGGACCTCTCTCCTCCCAC---------------------------
	* *** * ********* **** * ****** * **
	+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ +++++++++++++++++++ ++++++++++++++>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>	ENSRNOT00000004589 ENSRNOG00000003455 Zfp13
rat	((((...((((((((((((((.....((.((((((((((...((.((((((((((... .....)))))....))))) .))..))))).)))))))..)))))))))))))))))).	0.930 -54.20
human	..((.((. ((. ((((((.((.((.(((.....)))))))..)))))))))).)).....	0.489 -16.60

rat	chromosome:10:12851688:12851803:-1	Same_strand\|Intronic_coding\|ENSRNOT00000004589\|ENSRNOG00000003455 ## ENSRNOG00000003455\|protein_coding\|Zfp13\|zinc finger protein 13 Gene [Source:MGI Symbol;Acc:MGI:99159]
human	chromosome:16:3105719:3105874:1	Same_strand\|Boundary_coding\|ENST00000219091\|ENSG00000122386\|protein_coding\|Zinc finger protein 205 (Zinc finger protein 210) [Source:UniProtKB/Swiss-Prot;Acc:O95201]

block6619_cand

Cloning frequencies
absolute	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block6619_cand 3arm	0	1	0	0	0	0	0	0	0	1
normalized	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block6619_cand 3arm	0	0.000	0	0	0	0	0	0	0	0.000

block6619_cand relative cloning frequencies

block6619 [novel_mirtron_randfoldOK]

Hairpin parameters
miRNA	randfold	RNA	rep	GC min/max	len min/max/mir_range	5'var	3'var	reads	reads edited	libs	libs edited	base distance	loop distance	position	locations	exon distance	unpaired	max bulge	total reads	total libs	dicer	drosha
no	0.001	no	no	0.45/0.48	22/23/1.00	0.0	0.5	2	0	2	0	5	5	3arm	1	0	0.23	2	2	2	na	na

Families
Member of family novel77 (seed CUGACCC): block6619_cand, block2305240_cand

block6619 hairpin

		reads	miRBase family seed
seed	---------------------------------------------------------CUGACCC--------------------	2	novel
		len	cloning frequencies
			T1S2	T5S2
	--------------------------------------------------------TCTGACCCTGATTTTATCCCAG------	22	-	1
	--------------------------------------------------------TCTGACCCTGATTTTATCCCAGG-----	23	1	-
rat	--------TACGGGATGGGATGAGGCAGGGGAAAGGACAGACAGCACTTGGGCTTGTCTGACCCTGATTTTATCCCAGGACGTG
human	GTGGGCCCCAAGGGCAGGGAAGAGTCGGGGTGGAGTGGAGGC----------CCCATCTGACCCTAGTCTAACCCCAG------
	* * * * * ** * * ********* * * * *****
	+++++ ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++>>>>>>>>>>>	ENSRNOT00000018405 ENSRNOG00000013429 Tbl3
rat	((((...(((((((((((((((....(((((...(((......))))))))..))))).))))))))))...))))	1.000 -34.30
human	.((((......((((((((.(((...(((((.........)) ))).)))..)))).))))...)))).	0.414 -24.40

rat	chromosome:10:13954910:13954985:-1	Same_strand\|Boundary_coding\|ENSRNOT00000018405\|ENSRNOG00000013429 ## ENSRNOG00000013429\|protein_coding\|Tbl3\|transducin (beta)-like 3 [Source:RefSeq_peptide;Acc:NP_001008278]
human	chromosome:16:1967654:1967769:1	Same_strand\|Boundary_coding\|ENST00000332704\|ENSG00000183751\|protein_coding\|WD repeat-containing protein SAZD (Transducin beta-like 3 protein) [Source:UniProtKB/Swiss-Prot;Acc:Q12788] ## Same_strand\|Boundary_non-coding\|ENST00000355082\|ENSG00000183751\|protein_coding\|WD repeat-containing protein SAZD (Transducin beta-like 3 protein) [Source:UniProtKB/Swiss-Prot;Acc:Q12788]

block7261_cand

Cloning frequencies
absolute	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block7261_cand 3arm	0	0	0	0	1	0	0	0	0	0
normalized	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block7261_cand 3arm	0	0	0	0	0.000	0	0	0	0	0

block7261_cand relative cloning frequencies

block7261 [novel_mirtron_randfoldOK]

Hairpin parameters
miRNA	randfold	RNA	rep	GC min/max	len min/max/mir_range	5'var	3'var	reads	reads edited	libs	libs edited	base distance	loop distance	position	locations	exon distance	unpaired	max bulge	total reads	total libs	dicer	drosha
no	0.010	no	no	0.65/0.65	20/20/1.00	0.0	0.0	1	0	1	0	8	10	3arm	1	2	0.20	2	1	1	na	na

block7261 hairpin

		reads	miRBase family seed
seed	-----------------------------------------------------UGGCCUG--------------------	1	novel
		len	cloning frequencies
			T3S1
	----------------------------------------------------CTGGCCTGCTCACTCCTCCT--------	20	1
rat	ggggacatggaggggtcagagggtcaggacctagctgctcctgcagggattcCTGGCCTGCTCACTCCTCCTagggcctg
	********************************************************************************
	+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++>>>>>>>>>>>	ENSRNOT00000026139 ENSRNOG00000019174 NP_001099243.1
rat	.(((....((((((((.((.(((((((((((...((((....))))))..))))))))).)).)))))))).....))).	1.000 -41.20

rat

chromosome:10:14990336:14990415:-1

Same_strand|Intronic_coding|ENSRNOT00000026139|ENSRNOG00000019174 ## ENSRNOG00000019174|protein_coding|NP_001099243.1|CTF18, chromosome transmission fidelity factor 18 homolog [Source:RefSeq_peptide;Acc:NP_001099243]

block20878_cand

Cloning frequencies
absolute	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block20878_cand 3arm	1	0	0	0	0	0	0	0	0	0
normalized	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block20878_cand 3arm	0.000	0	0	0	0	0	0	0	0	0

block20878_cand relative cloning frequencies

block20878 [novel_mirtron_randfoldOK]

Hairpin parameters
miRNA	randfold	RNA	rep	GC min/max	len min/max/mir_range	5'var	3'var	reads	reads edited	libs	libs edited	base distance	loop distance	position	locations	exon distance	unpaired	max bulge	total reads	total libs	dicer	drosha
no	0.002	no	no	0.50/0.50	20/20/1.00	0.0	0.0	1	0	1	0	22	9	3arm	1	1	0.20	2	1	1	na	na

Families
Member of family novel80 (seed CUGACUC): block2150508_novel, block20878_cand

block20878 hairpin

		reads	miRBase family seed
seed	-------------------------------------------------------------------------CUGACUC----------------------------------	1	novel
		len	cloning frequencies
			T1S1
	------------------------------------------------------------------------TCTGACTCTTGTCCTGTCCA----------------------	20	1
rat	gtggccttccaagatggtgcagggacaggggcagtaggcaggggccggtcatcttaggtccccacctgagccTCTGACTCTTGTCCTGTCCAggagcacctgtctgtgagccac
	******************************************************************************************************************
	++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++>>>>>>>>>>>>>>>>>>>>>>>>>>	ENSRNOT00000006753 ENSRNOG00000004159 Fliih
rat	((((.((..((.((((((((..(((((.((((((.((.(((((((........((((((....))))))))))))).)).)))))))))))....))))).)))))..))))))	0.460 -53.10

rat

chromosome:10:46871817:46871930:-1

Same_strand|Intronic_coding|ENSRNOT00000006753|ENSRNOG00000004159 ## ENSRNOG00000004159|protein_coding|Fliih|flightless I homolog [Source:RefSeq_peptide;Acc:NP_001008280]

block24589_cand

Cloning frequencies
absolute	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block24589_cand 3arm	0	2	0	0	0	0	0	0	0	0
normalized	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block24589_cand 3arm	0	0.000	0	0	0	0	0	0	0	0

block24589_cand relative cloning frequencies

block24589 [novel_mirtron_randfoldOK]

Hairpin parameters
miRNA	randfold	RNA	rep	GC min/max	len min/max/mir_range	5'var	3'var	reads	reads edited	libs	libs edited	base distance	loop distance	position	locations	exon distance	unpaired	max bulge	total reads	total libs	dicer	drosha
no	0.009	no	no	0.52/0.52	23/23/1.00	0.0	0.0	2	0	1	0	22	12	3arm	1	0	0.22	3	2	1	na	na

Families
Member of family miR-483 (seed CACUCCU): rno-mir-483, block24589_cand

block24589 hairpin

		reads	miRBase family seed
seed	----------------------------------------------------------------------CACUCCU-------------------------------------	2	miR-483
		len	cloning frequencies
			T1S2
	---------------------------------------------------------------------TCACTCCTCTCCTTCACTTCCAG----------------------	23	2
rat	ggggaaggtcaggctgaggaaggcaggggggatgtgcaggctggggctggacctgaacgaacttggcctTCACTCCTCTCCTTCACTTCCAGgttacatggcattttcttctcc
	******************************************************************************************************************
	>>>>>>>>>>>>+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++>>>>>>>>>>>>>>>>>>>>>>>>>>>	ENSRNOT00000007087 ENSRNOG00000005193 LOC687570
rat	(((((((((((.(((..(((((..((((((((.(((.((((..((..((........))..))..)))).)))))))).)))...))))).)))....)))).....)))))))	0.980 -48.70

rat

chromosome:10:55746298:55746411:-1

Same_strand|Intronic_coding|ENSRNOT00000007087|ENSRNOG00000005193 ## ENSRNOG00000005193|protein_coding|LOC687570|phosphoribosylformylglycinamidine synthase (FGAR amidotransferase) [Source:RefSeq_peptide;Acc:NP_001099261]

Back to summary page

candidate novel miRNAs:

Jump 10 pages back

Page 150

Jump 10 pages forward

©2008 InteRNA Genomics B.V.