candidate novel miRNAs
novel_mirtron_randfoldOK (60 loci)
block2355811_cand
| absolute | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block2355811_cand 3arm | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 |
| normalized | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block2355811_cand 3arm | 0 | 0 | 0 | 0 | 0.000 | 0 | 0 | 0 | 0 | 0 |

block2355811 [novel_mirtron_randfoldOK]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| no | 0.001 | no | no | 0.60/0.60 | 20/20/1.00 | 0.0 | 0.0 | 1 | 0 | 1 | 0 | 24 | 14 | 3arm | 1 | 2 | 0.20 | 2 | 1 | 1 | na | na |
| Member of family novel181 (seed UCCCUCC): block2355811_cand, block2796013_cand |

| reads | miRBase family seed | ||
| seed | ------------------------------------------------------------------------------------------------UCCCUCC-------------------------------------------------------- | 1 | novel |
| len | cloning frequencies | ||
| T3S1 | |||
| -----------------------------------------------------------------------------------------------GTCCCTCCCTGCATGTAGAC-------------------------------------------- | 20 | 1 | |
| rat | -------------------GGATGGTGAGGCGCCTGGCTGGTAAGCAGGCAGGGTGGGAAGAAGGGGCAGCCATAGCTTTGGGCTCCCCCTAATCGTCCCTCCCTGCATGTAGACTGCTTTGGCTGCCTTTCCTGGTCA-------------------- | ||
| mouse | AGCATGGGCCTGTGTATGAAGATGGTGAGGCGCCTGGCTGGTAAGCAGGAGGGGTGGGCAGAAGGGGCAGCTATAGCATTGGGCTCCCCCTAACCGTCCCTCCCTGCATGCAGACTGCTTTGGCTGCCTCTCCTGGTCACACTCAGAGACGCACTTGTT | ||
| ***************************** ******* ************ ***** *************** **************** ****************** ********* | |||
| >>>>> >>>>>+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++>>>>>>>>>>>>>>>>>>>>>>>>>> >>>>> | ENSRNOT00000045410 ENSRNOG00000029572 Apeh | ||
| rat | .(((((.((((((((.(((.(((..(((.((((((.((((.(((((((.((((.........)))).)))))..)).)))).)))))).)))..))))))..))).))))).))..))). | 1.000 -62.70 | |
| mouse | ((((...(((((.((.(((....((.((((((((.(((..(((.(((((((((..((..((..((((.((((.........))))))))))..))..)))))).))).))).....)))..))).))))).))...))).)).)))....))...)))) | 0.987 -69.00 |
| rat | chromosome:8:113360342:113360461:-1 | Same_strand|Boundary_coding|ENSRNOT00000045410|ENSRNOG00000029572 ## ENSRNOG00000029572|protein_coding|Apeh|Acylamino-acid-releasing enzyme (EC 3.4.19.1) (AARE) (Acyl-peptide hydrolase) (APH) (Acylaminoacyl-peptidase). [Source:UniProtKB/Swiss-Prot;Acc:P13676] |
| mouse | chromosome:9:107995003:107995161:-1 | Same_strand|Boundary_coding|ENSMUST00000081309|ENSMUSG00000032590|protein_coding|acylpeptide hydrolase Gene [Source:MGI Symbol;Acc:MGI:88041] |
block2357765_cand
| absolute | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block2357765_cand 5arm | 0 | 2 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| normalized | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block2357765_cand 5arm | 0 | 0.000 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |

block2357765 [novel_mirtron_randfoldOK]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| no | 0.003 | no | no | 0.57/0.60 | 20/21/1.00 | 0.0 | 0.5 | 2 | 0 | 1 | 0 | 8 | 26 | 5arm | 1 | 1 | 0.24 | 3 | 2 | 1 | na | na |

| reads | miRBase family seed | ||
| seed | ---------CAGCCGA------------------------------------------------------------------------------------------- | 2 | novel |
| len | cloning frequencies | ||
| T1S2 | |||
| --------TCAGCCGACTCCTTTCCCTCA------------------------------------------------------------------------------ | 21 | 1 | |
| --------TCAGCCGACTCCTTTCCCTC------------------------------------------------------------------------------- | 20 | 1 | |
| rat | ctgacatcTCAGCCGACTCCTTTCCCTCAggtccccagttgggccatggatatgaatgtgctcatgtctgcccagctgctgatggagcaggtcgctgctgatagcag | ||
| *********************************************************************************************************** | |||
| +++++++++++++++++++++++++++++++++++>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> | ENSRNOT00000056130 ENSRNOG00000037181 AC158139.11 | ||
| rat | (((..(((.(((.(((((...((((.((((.....(((((((((...((((((((......))))))))))))))))))))).))))..))))))))..)))..))) | 1.000 -45.80 |
| rat | chromosome:8:115016621:115016727:-1 | Same_strand|Intronic_coding|ENSRNOT00000056130|ENSRNOG00000037181 ## Same_strand|Boundary_non-coding|ENSRNOT00000056129|ENSRNOG00000037181 ## ENSRNOG00000037181|protein_coding|AC158139.11|neurobeachin like 1 [Source:RefSeq peptide;Acc:NP_775620] |
block2450448_cand
| absolute | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block2450448_cand 3arm | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| normalized | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block2450448_cand 3arm | 0 | 0.000 | 0.000 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |

block2450448 [novel_mirtron_randfoldOK]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| no | 0.001 | no | no | 0.62/0.65 | 20/21/1.00 | 0.5 | 0.0 | 2 | 0 | 2 | 0 | 15 | 5 | 3arm | 1 | 0 | 0.19 | 3 | 2 | 2 | na | na |
| Member of family novel67 (seed CUCUGCC): block757922_cand, block2450448_cand |

| reads | miRBase family seed | |||
| seed | --------------------------------------------------------CUCUGCC---------------------------- | 1 | novel | |
| seed | ---------------------------------------------------------UCUGCCC--------------------------- | 1 | novel | |
| len | cloning frequencies | |||
| T1S2 | T2S1 | |||
| -------------------------------------------------------ACTCTGCCCTCCCTTGACCAG--------------- | 21 | - | 1 | |
| --------------------------------------------------------CTCTGCCCTCCCTTGACCAG--------------- | 20 | 1 | - | |
| rat | gggactggacccaactacttcaagtgggggtcaggaagtttgagatatgccttgaACTCTGCCCTCCCTTGACCAGgtttccccagaccca | |||
| ******************************************************************************************* | ||||
| +++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++>>>>>>>>>>>>>>>>>>>> | ENSRNOT00000021408 ENSRNOG00000015858 Hyal1 | |||
| rat | (((.((((....((((...(((((.(((((.(((..((((..((......))..)))))))))))).)))))...))))...)))).))). | 1.000 -37.40 | ||
| rat | chromosome:8:112824985:112825075:1 | Same_strand|Intronic_coding|ENSRNOT00000021408|ENSRNOG00000015858 ## ENSRNOG00000015858|protein_coding|Hyal1|Hyaluronidase-1 precursor (EC 3.2.1.35) (Hyal-1) (Hyaluronoglucosaminidase-1). [Source:UniProtKB/Swiss-Prot;Acc:Q76HN1] |
block2567348_cand
| absolute | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block2567348_cand 3arm | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| normalized | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block2567348_cand 3arm | 0.000 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |

block2567348 [novel_mirtron_randfoldOK]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| no | 0.001 | no | no | 0.59/0.59 | 22/22/1.00 | 0.0 | 0.0 | 1 | 0 | 1 | 0 | 25 | 12 | 3arm | 1 | 0 | 0.18 | 2 | 1 | 1 | na | na |

| reads | miRBase family seed | ||
| seed | --------------------------------------------------------------------UCUCCAU--------------------------------------- | 1 | novel |
| len | cloning frequencies | ||
| T1S1 | |||
| -------------------------------------------------------------------CTCTCCATCCCCTTCCTTCCAG------------------------- | 22 | 1 | |
| rat | aggagcaggtgagtagccaccagtgtggagttaggggtgggaccctggtggcactgccgcctcttcaCTCTCCATCCCCTTCCTTCCAGgtgaacaagtttctcacctcatcct | ||
| ****************************************************************************************************************** | |||
| ---------------------------------------------------------------------------------------------------------------------------- | ENSRNOT00000025335 ENSRNOG00000018741 LOC683524 | ||
| >>>>>>>>>>>>>+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> | ENSRNOT00000024266 ENSRNOG00000017857 LOC682940 | ||
| >>>>>>>>>>>>>+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> | ENSRNOT00000061305 ENSRNOG00000017857 LOC682940 | ||
| rat | ((((..(((((((.(((((((..((.((((..((((((((((....((((((...)))))).......)).))).)))))..)))))))))).....))).)))))))..)))) | 1.000 -49.60 |
| rat | chromosome:9:10029894:10030007:1 | Opposite_strand|Intronic_coding|ENSRNOT00000025335|ENSRNOG00000018741 ## Same_strand|Intronic_coding|ENSRNOT00000024266|ENSRNOG00000017857 ## ENSRNOG00000018741|protein_coding|LOC683524| ## ENSRNOG00000017857|protein_coding|LOC682940| |
block2737854_cand
| absolute | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block2737854_cand 3arm | 0 | 0 | 0 | 0.333 | 0 | 0 | 0 | 0 | 0 | 0 |
| normalized | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block2737854_cand 3arm | 0 | 0 | 0 | 0.000 | 0 | 0 | 0 | 0 | 0 | 0 |

block2737854 [novel_mirtron_randfoldOK]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| no | 0.008 | no | no | 0.60/0.60 | 20/20/1.00 | 0.0 | 0.0 | 1 | 0 | 1 | 0 | 9 | 21 | 3arm | 3 | 2 | 0.15 | 3 | 1 | 1 | na | na |

| reads | miRBase family seed | ||
| seed | --------------------------------------------------------------------------------------------AAGCCUG--------------------- | 1 | novel |
| len | cloning frequencies | ||
| T2S2 | |||
| -------------------------------------------------------------------------------------------AAAGCCTGAGCAGGTGGAGC--------- | 20 | 1 | |
| rat | aggacccagttgatctccaacctgaagaaagagggcttgttccacaactggcagcacatcaccgaccagattggcatgttctgcttcacttAAAGCCTGAGCAGGTGGAGCgactggcca | ||
| ************************************************************************************************************************ | |||
| >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>++>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> | ENSRNOT00000044402 ENSRNOG00000032385 | ||
| >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>++>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> | ENSRNOT00000050240 ENSRNOG00000032385 | ||
| rat | .((..(((((((..((((.(((((........((((((...........(((((.((((..((((.....)))).)))).))))).......))))))...)))))))))))))))))). | 0.800 -42.77 |
| rat | chromosome:X:83244688:83244807:-1 | Same_strand|Boundary_coding|ENSRNOT00000050240|ENSRNOG00000032385 ## ENSRNOG00000032385|protein_coding|| |
block115001_cand
| absolute | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block115001_cand 3arm | 7.500 | 0 | 1 | 0 | 2 | 0 | 0 | 1 | 1 | 0 |
| normalized | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block115001_cand 3arm | 0.000 | 0 | 0.000 | 0 | 0.000 | 0 | 0 | 0.000 | 0.000 | 0 |

block115001 [novel_cloningOK]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| no | 0.017 | no | no | 0.48/0.67 | 18/24/0.92 | 0.0 | 0.0 | 8 | 0 | 5 | 0 | 6 | 32 | 3arm | 1 | nd | 0.29 | 2 | 13 | 5 | na | na |
| Member of family novel14 (seed UUUUUGG): block115001_cand, block1369713_cand, block1404988_cand, block1426367_cand, block2490925_cand, block2730600_cand |

| reads | miRBase family seed | ||||||
| seed | --------------------------------------------------------------------------------------------UUUUUGG------------------- | 12 | novel | ||||
| seed | ---------------------------------------------------------------------------------------------------GGGGUGG------------ | 1 | novel | ||||
| len | cloning frequencies | ||||||
| T1S1 | T2S1 | T3S1 | T4S2 | T5S1 | |||
| -------------------------------------------------------------------------------------------TTTTTTGGGGGGTGGGGTTTT------ | 21 | 6 | 1 | 2 | - | 1 | |
| --------------------------------------------------------------------------------------------------GGGGGTGGGGTTTTGGTG-- | 18 | - | - | - | 1 | - | |
| -------------------------------------------------------------------------------------------TTTTTTGGGGGGTGGGGTTTTGGT--- | 24 | 1 | - | - | - | - | |
| -------------------------------------------------------------------------------------------TTTTTTGGGGGGTGGGGTTT------- | 20 | 1 | - | - | - | - | |
| rat | gatcaatgggcctctgatttttaagaagctataactaaactctcaggtgagttttttgtaagattaataggagagttgcaaatcatctgggTTTTTTGGGGGGTGGGGTTTTggtgat | ||||||
| ********************************************************************************************************************** | |||||||
| ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ | ENSRNOT00000049121 ENSRNOG00000006997 App | ||||||
| ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ | ENSRNOT00000042130 ENSRNOG00000006997 App | ||||||
| ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ | ENSRNOT00000048854 ENSRNOG00000006997 App | ||||||
| ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ | ENSRNOT00000044081 ENSRNOG00000006997 App | ||||||
| rat | .((((..(((((((...((..(((((((((.......(((((((..((.((((((....)))))).))..)))))))............)))))))))..))..)))))))...)))) | 0.910 -31.61 | |||||
| rat | chromosome:11:24480138:24480255:-1 | Same_strand|Intronic_coding|ENSRNOT00000049121|ENSRNOG00000006997 ## ENSRNOG00000006997|protein_coding|App|Amyloid beta A4 protein precursor (APP) (ABPP) (Alzheimer disease amyloid protein homolog) (Amyloidogenic glycoprotein) (AG) [Contains: Soluble APP-alpha (S-APP-alpha); Soluble APP-beta (S-APP-beta); C99; Beta-amyloid protein 42 (Beta-APP42); Beta-amyloid [Source:UniProtKB/Swiss-Prot;Acc:P08592] |
block174914_cand
| absolute | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block174914_cand 3arm | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 13 | 0 |
| normalized | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block174914_cand 3arm | 0 | 0 | 0.000 | 0 | 0 | 0 | 0 | 0 | 0.001 | 0 |

block174914 [novel_cloningOK]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| no | 0.012 | no | no | 0.40/0.45 | 19/25/0.79 | 0.0 0.3 | 0.0 1.3 | 9 3 | 0 0 | 2 1 | 0 0 | 41 29 | 0 8 | 3arm 3arm | 1 1 | nd nd | 0.33 0.20 | 6 2 | 14 | 2 | na | na |

| reads | miRBase family seed | |||
| seed | -----------------------------------------------------------GACCAAA------------------------------------------------------ | 10 | novel | |
| seed | -------------------------------------------------------------------GACCUAU---------------------------------------------- | 2 | novel | |
| seed | --------------------------------------------------------CCUGACC--------------------------------------------------------- | 1 | novel | |
| seed | --------------------------------------------------------------------ACCUAUG--------------------------------------------- | 1 | novel | |
| len | cloning frequencies | |||
| T2S1 | T5S1 | |||
| ----------------------------------------------------------TGACCAAATGACCTATGCTGT----------------------------------------- | 21 | 1 | 9 | |
| ------------------------------------------------------------------TGACCTATGCTGTTTTCCAGATATG----------------------------- | 25 | - | 2 | |
| -------------------------------------------------------------------GACCTATGCTGTTTTCCAGA--------------------------------- | 20 | - | 1 | |
| -------------------------------------------------------TCCTGACCAAATGACCTAT---------------------------------------------- | 19 | - | 1 | |
| rat | cctgtgccaagagaagggcaatggctggcccagagatggcaaaggcctgggtcaatccTGACCAAATGACCTATGCTGTtttccagatatgcagaccacatcctgtctctttttcacagt | |||
| ************************************************************************************************************************ | ||||
| rat | .(((((..((((((.(((...(((((((....(((((((((.(((....(((((....)))))......))).))))))))))))).........)))...))).))))))...))))). | 0.760 -39.40 | ||
| rat | chromosome:11:84966347:84966466:1 | intergenic |
block333328_cand
| absolute | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block333328_cand 3arm | 5 | 5 | 6 | 3 | 5 | 4 | 3 | 1 | 1 | 3 |
| normalized | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block333328_cand 3arm | 0.000 | 0.000 | 0.000 | 0.000 | 0.000 | 0.000 | 0.000 | 0.000 | 0.000 | 0.000 |

block333328 [novel_cloningOK]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| no | 0.034 | no | no | 0.73/0.80 | 18/23/0.75 | 0.0 | 1.5 | 36 | 0 | 10 | 0 | 31 | 2 | 3arm | 1 | nd | 0.05 | 1 | 36 | 10 | na | na |

| reads | miRBase family seed | |||||||||||
| seed | -----------------------------------------------------------------CGAGCCU---------------------------------------------- | 35 | novel | |||||||||
| seed | ------------------------------------------------------------------GAGCCUC--------------------------------------------- | 1 | novel | |||||||||
| len | cloning frequencies | |||||||||||
| T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 | |||
| ----------------------------------------------------------------TCGAGCCTCGCGTCCGCCGAC--------------------------------- | 21 | - | - | - | 2 | 2 | 2 | 1 | 1 | - | 1 | |
| ----------------------------------------------------------------TCGAGCCTCGCGTCCGCCGACAC------------------------------- | 23 | 2 | 1 | 1 | - | 2 | 1 | - | - | - | 1 | |
| ----------------------------------------------------------------TCGAGCCTCGCGTCCGCC------------------------------------ | 18 | 1 | 1 | 1 | 1 | - | 1 | 2 | - | 1 | - | |
| ----------------------------------------------------------------TCGAGCCTCGCGTCCGCCGA---------------------------------- | 20 | - | 2 | 3 | - | 1 | - | - | - | - | 1 | |
| ----------------------------------------------------------------TCGAGCCTCGCGTCCGCCGACA-------------------------------- | 22 | 1 | - | 1 | - | - | - | - | - | - | - | |
| ----------------------------------------------------------------TCGAGCCTCGCGTCCGCCG----------------------------------- | 19 | 1 | - | - | - | - | - | - | - | - | - | |
| -----------------------------------------------------------------CGAGCCTCGCGTCCGCCGAC--------------------------------- | 20 | - | 1 | - | - | - | - | - | - | - | - | |
| rat | GCCCCCACGGCCAGCCGTGGCGGTTGTCAAGGCGCGGGCGCGGGGCTCCGCCATAAAGGGGGGGTCGAGCCTCGCGTCCGCCGACACAAATCCGCCTGCGCCTCCGTGCTTAAAGGGG | |||||||||||
| mouse | ------------------------CGTCAAGGCGCGGGCGCGGGGCTCCGCCATAAA-GGGGAGTCGAGCCTCGCGTCCGCCGACA-------------------------------- | |||||||||||
| ******************************** **** *********************** | ||||||||||||
| rat | .(((((((((..((.((((((((.((((.....(((((((((((((((.(((..........))).))))))))))))))).)))).....))))).))).)))))))......)))) | 0.860 -63.40 | ||||||||||
| mouse | .(((.....(((((((((((((((..((..... ..))....))))))))))))))).))). | 0.994 -35.60 | ||||||||||
| rat | chromosome:14:2325995:2326112:-1 | intergenic ## {SimpF: 1 Eponine, -1 Eponine} |
| mouse | chromosome:5:108416179:108416336:1 | intergenic ## {Repeats: dust 0 class=dust} ## {SimpF: oe = 0.96 1 CpG, -1 Eponine, -1 Eponine, 1 Eponine, -1 Eponine, 1 Eponine, -1 Eponine} |
block361641_cand
| absolute | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block361641_cand 3arm | 1 | 0 | 3 | 0 | 1 | 1 | 2 | 0 | 18 | 2 |
| normalized | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block361641_cand 3arm | 0.000 | 0 | 0.000 | 0 | 0.000 | 0.000 | 0.000 | 0 | 0.001 | 0.000 |

block361641 [novel_cloningOK]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| no | 0.836 | no | no | 0.32/0.35 | 19/20/0.75 | 0.0 | 0.0 | 14 | 0 | 7 | 0 | 18 | 1 | 3arm | 1 | nd | 0.30 | 2 | 28 | 7 | na | na |

| reads | miRBase family seed | ||||||||
| seed | -------------------------------------------------------------UUAAUGA------------------------------ | 28 | novel | ||||||
| len | cloning frequencies | ||||||||
| T1S1 | T2S1 | T3S1 | T3S2 | T4S1 | T5S1 | T5S2 | |||
| ------------------------------------------------------------TTTAATGATGACTTCTGGTG------------------ | 20 | 1 | 2 | 1 | 1 | 1 | 14 | 1 | |
| ------------------------------------------------------------TTTAATGATGACTTCTGGT------------------- | 19 | - | 1 | - | - | 1 | 4 | 1 | |
| rat | gaggctttcccttatgttgctaactgaaggaatttcttaaagaattgaagacccccccccTTTAATGATGACTTCTGGTGccaattcacaatgctttt | ||||||||
| ************************************************************************************************** | |||||||||
| rat | (((((..........((((...(((((((..(((..((((((.................)))))).)))..)))).)))..)))).......))))). | 0.600 -13.56 | |||||||
| rat | chromosome:14:71291989:71292086:-1 | intergenic |
block379175_cand
| absolute | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block379175_cand 5arm | 4 | 5 | 3 | 2 | 0 | 3 | 0 | 0 | 0 | 0 |
| normalized | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block379175_cand 5arm | 0.000 | 0.000 | 0.000 | 0.000 | 0 | 0.000 | 0 | 0 | 0 | 0 |

block379175 [novel_cloningOK]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| no | 0.100 | no | no | 0.55/0.61 | 18/25/0.82 | 0.6 | 1.2 | 17 | 0 | 5 | 0 | 31 | 0 | 5arm | 1 | 25 | 0.20 | 2 | 17 | 5 | na | na |
| Member of family novel121 (seed UGCGGGA): block270016_cand, block379175_cand |

| reads | miRBase family seed | ||||||
| seed | ---------------------------------GCGGGAA------------------------------------------------------------- | 9 | novel | ||||
| seed | --------------------------------UGCGGGA-------------------------------------------------------------- | 7 | novel | ||||
| seed | ----------------------------------CGGGAAG------------------------------------------------------------ | 1 | novel | ||||
| len | cloning frequencies | ||||||
| T1S1 | T1S2 | T2S1 | T2S2 | T3S2 | |||
| -------------------------------TTGCGGGAAGGGTAGCATGAGT------------------------------------------------ | 22 | 3 | 1 | 2 | - | - | |
| --------------------------------TGCGGGAAGGGTAGCATGAG------------------------------------------------- | 20 | - | 1 | 1 | - | 1 | |
| --------------------------------TGCGGGAAGGGTAGCATGAGT------------------------------------------------ | 21 | 1 | - | - | 1 | - | |
| --------------------------------TGCGGGAAGGGTAGCATGAGTACC--------------------------------------------- | 24 | - | 1 | - | 1 | - | |
| --------------------------------TGCGGGAAGGGTAGCATG--------------------------------------------------- | 18 | - | - | - | - | 1 | |
| --------------------------------TGCGGGAAGGGTAGCATGA-------------------------------------------------- | 19 | - | 1 | - | - | - | |
| -------------------------------TTGCGGGAAGGGTAGCATGAGTACC--------------------------------------------- | 25 | - | - | - | - | 1 | |
| ---------------------------------GCGGGAAGGGTAGCATGAGTACC--------------------------------------------- | 23 | - | 1 | - | - | - | |
| rat | ggctcaagtaagactcaaagcacaggatctgTTGCGGGAAGGGTAGCATGAGTACCtagaacctggactctgagcctcttccccacagggtaggtgtggcc | ||||||
| ***************************************************************************************************** | |||||||
| >>>>>>>>>>>>+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++>>>>>>>>>>>>>>>>>> | ENSRNOT00000032056 ENSRNOG00000024112 Dgkq | ||||||
| rat | ((((...............((((....((((.((.(((((((((..((.((((.((........)))))))).))).))))))))))))....)))))))) | 0.440 -34.46 | |||||
| rat | chromosome:14:1606526:1606626:1 | Same_strand|Intronic_coding|ENSRNOT00000032056|ENSRNOG00000024112 ## ENSRNOG00000024112|protein_coding|Dgkq|diacylglycerol kinase, theta Gene [Source:MGI (curated);Acc:Dgkq-001] |
| Back to summary page | candidate novel miRNAs: | Page 1 | Jump 10 pages back | Previous page | Page 156 | Next page | Jump 10 pages forward | Page 178 |
