candidate novel miRNAs
novel_shortStem_mirtron_randfoldOK (20 loci)
block3196951_cand
| absolute | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block3196951_cand 3arm | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| normalized | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block3196951_cand 3arm | 0 | 0.000 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
block3196951 [novel_shortStem_mirtron_randfoldOK]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| no | 0.004 | no | no | 0.67/0.67 | 21/21/1.00 | 0.0 | 0.0 | 1 | 0 | 1 | 0 | 1 | 10 | 3arm | 1 | 0 | 0.19 | 1 | 1 | 1 | na | na |
| Member of family novel140 (seed UGACCUG): block1506205_cand, block3196951_cand |
| reads | miRBase family seed | ||
| seed | ----------------------------------------------------UGACCUG-------------- | 1 | novel |
| len | cloning frequencies | ||
| T1S2 | |||
| ---------------------------------------------------CTGACCTGTCCTGCCCTCCAG- | 21 | 1 | |
| rat | ctgggggtaccttaggaagggcagggaataagtggaaaagcctagtttttcCTGACCTGTCCTGCCCTCCAGg | ||
| ************************************************************************* | |||
| +++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++>>>>>> | ENSRNOT00000008910 ENSRNOG00000037239 Flna_predicted | ||
| rat | ((((((((.....((((.((((((((((.((.(((......))).))))))))).))).)))))))).)))). | 0.870 -32.30 |
| rat | chromosome:X:160373737:160373809:1 | Same_strand|Intronic_coding|ENSRNOT00000008910|ENSRNOG00000037239 ## ENSRNOG00000037239|protein_coding|Flna_predicted| |
block1903933_cand
| absolute | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block1903933_cand 3arm | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| normalized | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block1903933_cand 3arm | 0 | 0.000 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
block1903933 [novel_shortStem_mirtron_randfoldOK]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| no | 0.001 | no | no | 0.57/0.57 | 21/21/1.00 | 0.0 | 0.0 | 1 | 0 | 1 | 0 | 3 | 7 | 3arm | 1 | 0 | 0.14 | 2 | 1 | 1 | na | na |
| Member of family novel105 (seed UGACCCC): block1675026_cand, block1903933_cand |
| reads | miRBase family seed | ||
| seed | ----------------------------------------------------UGACCCC---------------- | 1 | novel |
| len | cloning frequencies | ||
| T1S2 | |||
| ---------------------------------------------------CTGACCCCACAAACCCCATAG--- | 21 | 1 | |
| rat | GCCATGTGGGGACTGTGGGGACAAGATGGACCCACATCCCACCACCAATCCCTGACCCCACAAACCCCATAGGTG | ||
| mouse | --CATGTGGGGACTGTGGGGACAAGAGGCACCCACATCCCACCACCAACCCCTGACCCCACAAACCCCGTAG--- | ||
| ************************ * ******************* ******************* *** | |||
| +++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++>>>>>>>> | ENSRNOT00000026439 ENSRNOG00000019423 Dvl1 | ||
| rat | (((.(((((((..(((((((.((.(((((...............))).))..)).)))))))..)))))))))). | 0.490 -31.06 | |
| mouse | ..(((((((..(((((((...((.((....................)).))..)))))))..))))))). | 0.943 -22.95 |
| rat | chromosome:5:172713456:172713530:1 | Same_strand|Intronic_coding|ENSRNOT00000026439|ENSRNOG00000019423 ## ENSRNOG00000019423|protein_coding|Dvl1|Segment polarity protein dishevelled homolog DVL-1 (Dishevelled-1) (DSH homolog 1). [Source:UniProtKB/Swiss-Prot;Acc:Q9WVB9] |
| mouse | chromosome:4:155229121:155229235:1 | Same_strand|Boundary_coding|ENSMUST00000030948|ENSMUSG00000029071|protein_coding|dishevelled, dsh homolog 1 (Drosophila) Gene [Source:MGI (curated);Acc:Dvl1-001] |
novel_cloningOK_mirtron (16 loci)
block81687_cand
| absolute | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block81687_cand 5arm | 6 | 1 | 0 | 0 | 3 | 2 | 0 | 0 | 2 | 0 |
| normalized | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block81687_cand 5arm | 0.000 | 0.000 | 0 | 0 | 0.000 | 0.000 | 0 | 0 | 0.000 | 0 |
block81687 [novel_cloningOK_mirtron]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| no | 0.133 | no | no | 0.56/0.60 | 18/22/0.79 | 0.1 | 1.6 | 14 | 0 | 5 | 0 | 22 | 2 | 5arm | 1 | 0 | 0.16 | 2 | 14 | 5 | na | na |
| reads | miRBase family seed | ||||||
| seed | ------------------------CAUGUGC---------------------------------------------------------------------------------- | 12 | novel | ||||
| seed | -----------------------UCAUGUG----------------------------------------------------------------------------------- | 2 | novel | ||||
| len | cloning frequencies | ||||||
| T1S1 | T1S2 | T3S1 | T3S2 | T5S1 | |||
| -----------------------TCATGTGCTTCCTCGCCTCCAG-------------------------------------------------------------------- | 22 | 3 | 1 | 1 | - | 1 | |
| -----------------------TCATGTGCTTCCTCGCCTCC---------------------------------------------------------------------- | 20 | 2 | - | - | 2 | - | |
| ----------------------TTCATGTGCTTCCTCGCC------------------------------------------------------------------------- | 18 | 1 | - | - | - | 1 | |
| -----------------------TCATGTGCTTCCTCGCCTC----------------------------------------------------------------------- | 19 | - | - | 1 | - | - | |
| -----------------------TCATGTGCTTCCTCGCCTCCA--------------------------------------------------------------------- | 21 | - | - | 1 | - | - | |
| rat | GATCCATCTCTGTGAACAAGTCTTCATGTGCTTCCTCGCCTCCAGCATCACGTTTGCAGGGGGTCCAGGCAGG-GATGGCATCATCGACTTCACATCTGGCTC---------- | ||||||
| human | ----------------------TTCATGTGCTTCCTCCTCATCAACCTGCTCCATCTAGAAAGT---GGTAGGAGAAGGC-----------CACA---AGCT----------- | ||||||
| mouse | -------CTCTGTAACCAAGTCTTCATGTGCTTCCTTGCCTCCAGCATAACGTTTGCAGGGGGTCCAGGCAGG-GACGGCATCATTGACTTCACATCGGGCTCAGAGCTTCTC | ||||||
| ************** * ** * * * ** ** ** *** ** *** **** *** | |||||||
| ++++++++++++++++++++++++++++++++++++++++++++++++++>>>>>>>>>>>>>>>>>>>>>>>>>>>> >>>>>>>>>>>>>>>>>>>>>>>>>>>>> >>>>> | ENSRNOT00000036666 ENSRNOG00000004072 Myo1c | ||||||
| rat | ((.(((....(((((...((((...((((((((((..((((((.(((.......)))...))....))))..) )).)))).))).)))))))))..))).)) | 0.450 -30.10 | |||||
| human | ....(((((((.(((((.((((.....((......))....) )))))))).)))) .))) .... | 0.997 -15.90 | |||||
| mouse | (((((...(((((((...((((((((((((((((((.(((.......)))...))....))))))) )).)))).))).)))))......))...)))))...... | 0.890 -35.80 | |||||
| rat | chromosome:10:63006072:63006173:1 | Same_strand|Intronic_non-coding|ENSRNOT00000036666|ENSRNOG00000004072 ## ENSRNOG00000004072|protein_coding|Myo1c|myosin IC [Source:RefSeq_peptide;Acc:NP_075580] |
| human | chromosome:9:134678540:134678681:1 | Opposite_strand|Intronic_coding|ENST00000298545|ENSG00000165695|protein_coding|Putative adenylate kinase-like protein C9orf98 (EC 2.7.4.3) [Source:UniProtKB/Swiss-Prot;Acc:Q96MA6] |
| mouse | chromosome:11:75485616:75485720:1 | Same_strand|Boundary_coding|ENSMUST00000102505|ENSMUSG00000017774|protein_coding|myosin IC Gene [Source:MGI (curated);Acc:Myo1c-002] ## Same_strand|Boundary_non-coding|ENSMUST00000108427|ENSMUSG00000017774|protein_coding|myosin IC Gene [Source:MGI (curated);Acc:Myo1c-002] |
block564106_cand
| absolute | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block564106_cand 5arm | 0 | 3 | 0 | 1 | 0 | 2 | 0 | 0 | 0 | 4 |
| normalized | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block564106_cand 5arm | 0 | 0.000 | 0 | 0.000 | 0 | 0.000 | 0 | 0 | 0 | 0.000 |
block564106 [novel_cloningOK_mirtron]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| no | 0.270 | no | no | 0.38/0.42 | 18/24/0.80 | 0.2 | 1.7 | 10 | 0 | 4 | 0 | 7 | 1 | 5arm | 1 | 1 | 0.29 | 3 | 10 | 4 | na | na |
| Member of family novel223 (seed CUUCCUU): block564106_cand, sblock3126_cand |
| reads | miRBase family seed | |||||
| seed | ---------UUCCUUA------------------------------------------------------- | 8 | novel | |||
| seed | ----------UCCUUAA------------------------------------------------------ | 1 | novel | |||
| seed | --------CUUCCUU-------------------------------------------------------- | 1 | novel | |||
| len | cloning frequencies | |||||
| T1S2 | T2S2 | T3S2 | T5S2 | |||
| --------CTTCCTTAACTGAACTTCTCCAGA--------------------------------------- | 24 | 1 | - | 2 | - | |
| --------CTTCCTTAACTGAACTTCTC------------------------------------------- | 20 | - | - | - | 3 | |
| --------CTTCCTTAACTGAACTTC--------------------------------------------- | 18 | 2 | - | - | - | |
| -------ACTTCCTTAACTGAACTTCTC------------------------------------------- | 21 | - | 1 | - | - | |
| ---------TTCCTTAACTGAACTTCTCC------------------------------------------ | 20 | - | - | - | 1 | |
| rat | GCATTGTACTTCCTTAACTGAACTTCTCCAGATCCCGCAGTTTGAAGATGTTAAATTTGAGGCAGCGAGCC | |||||
| mouse | -------ACTTCCTTAACTGAACTTCTCCAGATCCCACAGTTTGAAGATGTTAAATTTGAGGCAGC----- | |||||
| ***************************** ***************************** | ||||||
| ++++++++++++++++++++++++++++++++++++>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> | ENSRNOT00000027846 ENSRNOG00000020526 NP_001099547.1 | |||||
| rat | ((.((((....((((((...(((.(((.(((((......))))).))).)))....))))))..)))))). | 1.000 -15.20 | ||||
| mouse | .((.((((((...(((.(((.(((((......))))).))).)))....)))))).)). | 1.000 -13.10 | ||||
| rat | chromosome:16:19878034:19878104:1 | Same_strand|Boundary_coding|ENSRNOT00000027846|ENSRNOG00000020526 ## ENSRNOG00000020526|protein_coding|NP_001099547.1| |
| mouse | chromosome:8:72557084:72557194:-1 | Same_strand|Boundary_coding|ENSMUST00000050561|ENSMUSG00000031858|protein_coding|RIKEN cDNA 9130404D08 gene Gene [Source:MGI Symbol;Acc:MGI:1921799] |
block861091_cand
| absolute | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block861091_cand 5arm | 4 | 4 | 0 | 2 | 0 | 1 | 0 | 0 | 0 | 0 |
| normalized | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block861091_cand 5arm | 0.000 | 0.000 | 0 | 0.000 | 0 | 0.000 | 0 | 0 | 0 | 0 |
block861091 [novel_cloningOK_mirtron]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| no | 0.867 | no | no | 0.57/0.59 | 19/24/0.91 | 0.0 | 0.9 | 11 | 0 | 4 | 0 | 16 | 15 | 5arm | 1 | 0 | 0.26 | 2 | 11 | 4 | na | na |
| reads | miRBase family seed | |||||
| seed | -----------------CUAGCUC------------------------------------------------------------------------------------- | 11 | novel | |||
| len | cloning frequencies | |||||
| T1S1 | T1S2 | T2S2 | T3S2 | |||
| ----------------CCTAGCTCTACTGTCCCACCAG----------------------------------------------------------------------- | 22 | 1 | 3 | - | 1 | |
| ----------------CCTAGCTCTACTGTCCCACCA------------------------------------------------------------------------ | 21 | 1 | - | 2 | - | |
| ----------------CCTAGCTCTACTGTCCCACCAGAC--------------------------------------------------------------------- | 24 | 1 | 1 | - | - | |
| ----------------CCTAGCTCTACTGTCCCAC-------------------------------------------------------------------------- | 19 | 1 | - | - | - | |
| rat | gggccaagctgcaagcCCTAGCTCTACTGTCCCACCAGACcagaagcccgacgtgatgtacgccgatattggaggcatggacatccagaagcaggaggtgcgggaggct | |||||
| ************************************************************************************************************* | ||||||
| +++++++++++++++++++++++++++++++++++++++++++>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> | ENSRNOT00000025819 ENSRNOG00000018994 Psmc4 | |||||
| rat | .((((...(((((...(((.(((((..(((((..((...((((.....((.((((...)))).))...)))).))...)))))...))).)))))...)))))..)))) | 0.840 -31.70 | ||||
| rat | chromosome:1:83156489:83156597:-1 | Same_strand|Boundary_coding|ENSRNOT00000025819|ENSRNOG00000018994 ## ENSRNOG00000018994|protein_coding|Psmc4|26S protease regulatory subunit 6B (Proteasome 26S subunit ATPase 4) (TAT-binding protein 7) (TBP-7). [Source:UniProtKB/Swiss-Prot;Acc:Q63570] |
block867555_cand
| absolute | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block867555_cand 3arm | 15 | 7 | 1 | 1 | 1 | 1 | 2 | 1 | 1 | 2 |
| normalized | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block867555_cand 3arm | 0.000 | 0.000 | 0.000 | 0.000 | 0.000 | 0.000 | 0.000 | 0.000 | 0.000 | 0.000 |
block867555 [novel_cloningOK_mirtron]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| no | 0.104 | no | no | 0.59/0.68 | 19/22/0.81 | 0.0 | 0.3 | 11 | 0 | 10 | 0 | 10 | 18 | 3arm | 1 | 1 | 0.24 | 2 | 32 | 10 | na | na |
| Member of family novel158 (seed GCCCUCU): block867555_cand, block2058144_cand |
| reads | miRBase family seed | |||||||||||
| seed | -------------------------------------------------------------------------------------GCCCUCU------------------------ | 31 | novel | |||||||||
| seed | --------------------------------------------------------------------------------------CCCUCUC----------------------- | 1 | novel | |||||||||
| len | cloning frequencies | |||||||||||
| T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 | |||
| ------------------------------------------------------------------------------------TGCCCTCTCACTCTGCCCCAA----------- | 21 | 8 | 1 | - | - | - | - | 2 | 1 | - | - | |
| ------------------------------------------------------------------------------------TGCCCTCTCACTCTGCCCCA------------ | 20 | 2 | 1 | 1 | - | 1 | 1 | - | - | 1 | - | |
| ------------------------------------------------------------------------------------TGCCCTCTCACTCTGCCCC------------- | 19 | 2 | 2 | - | 1 | - | - | - | - | - | 1 | |
| ------------------------------------------------------------------------------------TGCCCTCTCACTCTGCCCCAAA---------- | 22 | 2 | 3 | - | - | - | - | - | - | - | 1 | |
| -------------------------------------------------------------------------------------GCCCTCTCACTCTGCCCCAA----------- | 20 | 1 | - | - | - | - | - | - | - | - | - | |
| rat | ggcatggagtggagtcatggagtggcaagaggtgagctgcgggggctgagtgggctgctggccctaagctgccctcccctgaagTGCCCTCTCACTCTGCCCCAAAgcccaggcct | |||||||||||
| ******************************************************************************************************************** | ||||||||||||
| >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++>>>>>>>>>>>>>> | ENSRNOT00000027580 ENSRNOG00000020358 Ptov1 | |||||||||||
| rat | (((.(((..(((.((...((((((...(((((...(((.((((((......((((.(((.......))).)))).)))))).)))..))))))))))))).)))....))).))). | 0.990 -51.70 | ||||||||||
| rat | chromosome:1:95337621:95337736:-1 | Same_strand|Intronic_coding|ENSRNOT00000027580|ENSRNOG00000020358 ## ENSRNOG00000020358|protein_coding|Ptov1|Prostate tumor overexpressed gene 1 protein homolog. [Source:UniProtKB/Swiss-Prot;Acc:Q5U2W6] |
block1021226_cand
| absolute | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block1021226_cand 3arm | 15 | 5 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| normalized | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block1021226_cand 3arm | 0.000 | 0.000 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
block1021226 [novel_cloningOK_mirtron]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| no | 0.014 | no | no | 0.55/0.58 | 19/21/0.80 | 0.0 | 0.5 | 16 | 0 | 2 | 0 | 9 | 6 | 3arm | 1 | 0 | 0.26 | 3 | 20 | 2 | na | na |
| reads | miRBase family seed | |||
| seed | -------------------------------------------------UGUUCUC---------------------- | 20 | novel | |
| len | cloning frequencies | |||
| T1S1 | T1S2 | |||
| ------------------------------------------------CTGTTCTCCCTTACCTCCCAG--------- | 21 | 9 | 3 | |
| ------------------------------------------------CTGTTCTCCCTTACCTCCCA---------- | 20 | 2 | 2 | |
| ------------------------------------------------CTGTTCTCCCTTACCTCCC----------- | 19 | 4 | - | |
| rat | ccaggcatgggagcaggtataggagcccaaggccttgcacatgtaagaCTGTTCTCCCTTACCTCCCAGgctacaagg | |||
| ****************************************************************************** | ||||
| ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++>>>>>>>>>>>>>> | ENSRNOT00000037405 ENSRNOG00000027098 Sez6l2_predicted | |||
| rat | ...(((.(((((...((((..((((....((..(((((....))))).))...))))..))))))))).)))...... | 1.000 -28.00 | ||
| rat | chromosome:1:186145286:186145363:1 | Same_strand|Intronic_coding|ENSRNOT00000037405|ENSRNOG00000027098 ## ENSRNOG00000027098|protein_coding|Sez6l2_predicted|seizure related 6 homolog (mouse)-like 2 [Source:RefSeq_peptide;Acc:NP_001101020] |
block1098089_cand
| absolute | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block1098089_cand 3arm | 4 | 2 | 0 | 0 | 5 | 0 | 0 | 0 | 1 | 0 |
| normalized | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block1098089_cand 3arm | 0.000 | 0.000 | 0 | 0 | 0.000 | 0 | 0 | 0 | 0.000 | 0 |
block1098089 [novel_cloningOK_mirtron]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| no | 0.124 | no | no | 0.58/0.65 | 20/24/1.00 | 0.8 | 1.1 | 12 | 0 | 4 | 0 | 8 | 5 | 3arm | 1 | 0 | 0.29 | 3 | 12 | 4 | na | na |
| Member of family novel184 (seed CUCUGGC): block1098089_cand, block1568221_cand |
| reads | miRBase family seed | |||||
| seed | ---------------------------------------------------CUGGCGU----------------------- | 6 | novel | |||
| seed | -------------------------------------------------CUCUGGC------------------------- | 4 | novel | |||
| seed | ----------------------------------------------------UGGCGUC---------------------- | 2 | novel | |||
| len | cloning frequencies | |||||
| T1S1 | T1S2 | T3S1 | T5S1 | |||
| --------------------------------------------------TCTGGCGTCTGCTTCACCCTCA--------- | 22 | 1 | - | 3 | - | |
| ------------------------------------------------TCTCTGGCGTCTGCTTCACCC------------ | 21 | 2 | - | - | - | |
| --------------------------------------------------TCTGGCGTCTGCTTCACCCTC---------- | 21 | - | - | 1 | - | |
| ------------------------------------------------TCTCTGGCGTCTGCTTCACCCT----------- | 22 | 1 | - | - | - | |
| ------------------------------------------------TCTCTGGCGTCTGCTTCACCCTCA--------- | 24 | - | 1 | - | - | |
| --------------------------------------------------TCTGGCGTCTGCTTCACCCT----------- | 20 | - | 1 | - | - | |
| ---------------------------------------------------CTGGCGTCTGCTTCACCCTC---------- | 20 | - | - | - | 1 | |
| ---------------------------------------------------CTGGCGTCTGCTTCACCCTCAG-------- | 22 | - | - | 1 | - | |
| rat | cccatgctgtgagagtggcagggtgtccgagagcccacactaatgagcTCTCTGGCGTCTGCTTCACCCTCAGctccctgg | |||||
| ********************************************************************************* | ||||||
| ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++>>>>>>>>>>>>> | ENSRNOT00000058786 ENSRNOG00000001203 NP_001012073.1 | |||||
| ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++>>>>>>>>>>>>> | ENSRNOT00000001597 ENSRNOG00000001203 NP_001012073.1 | |||||
| rat | .(((.((..((((.((((..((..(((.((((((.((......)).)))))).)))..))...)))).))))))....))) | 1.000 -29.00 | ||||
| rat | chromosome:20:10602055:10602135:1 | Same_strand|Intronic_coding|ENSRNOT00000001597|ENSRNOG00000001203 ## ENSRNOG00000001203|protein_coding|NP_001012073.1|novel nuclear protein 1 [Source:RefSeq_peptide;Acc:NP_001012073] |
block1312042_cand
| absolute | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block1312042_cand 3arm | 5 | 1 | 0 | 0 | 5 | 9 | 1 | 2 | 1 | 0 |
| normalized | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block1312042_cand 3arm | 0.000 | 0.000 | 0 | 0 | 0.000 | 0.001 | 0.000 | 0.000 | 0.000 | 0 |
block1312042 [novel_cloningOK_mirtron]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| no | 0.011 | no | no | 0.61/0.65 | 19/23/0.88 | 0.0 | 0.4 | 14 | 0 | 7 | 0 | 23 | 7 | 3arm | 1 | 0 | 0.24 | 3 | 24 | 7 | na | na |
| reads | miRBase family seed | ||||||||
| seed | ---------------------------------------------------------------------------------GACCUGU------------------------------------------------------------ | 23 | novel | ||||||
| seed | ----------------------------------------------------------------------------------ACCUGUG----------------------------------------------------------- | 1 | novel | ||||||
| len | cloning frequencies | ||||||||
| T1S1 | T1S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | |||
| --------------------------------------------------------------------------------TGACCTGTGGCTCC-TCTCCCAG--------------------------------------------- | 22 | 1 | - | 4 | 5 | - | 1 | - | |
| --------------------------------------------------------------------------------TGACCTGTGGCTCC-TCTCCCA---------------------------------------------- | 21 | 3 | - | - | 1 | - | - | - | |
| --------------------------------------------------------------------------------TGACCTGTGGCTCC-TCTCC------------------------------------------------ | 19 | 1 | - | - | 1 | 1 | - | - | |
| --------------------------------------------------------------------------------TGACCTGTGGCTCC-TCTCCCAG--A------------------------------------------ | 23 | - | - | - | 2 | - | - | 1 | |
| --------------------------------------------------------------------------------TGACCTGTGGCTCC-TCTCCC----------------------------------------------- | 20 | - | 1 | - | - | - | 1 | - | |
| ---------------------------------------------------------------------------------GACCTGTGGCTCC-TCTCCCA---------------------------------------------- | 20 | - | - | 1 | - | - | - | - | |
| rat | ------GAGAGGTGAGCCTAGGGCTGGGC-----TGGATGAAAGGAGAGGAGTTGGCAGGGGCTGGCTATGAGCAT--CCTGACCTGTGGCTCC-TCTCCCAG--ATGTCTCCCTATG-----ACAACCTGCTC-------------- | ||||||||
| human | -----------GTGAA---AGAGCTGAGAAAATGTGGA-GGGAGGACAGGGATGGACGGGG---------GAGTATGCTCTGACCTGTTTCTCTGTCCCCCAGGCACATCTCCCACTTCATTCACAACGTTCCCTTCC---------- | ||||||||
| mouse | GCAGGTGAGAGGTGAGCCTAGGGCTGGGC-----TGGACGGAAGGAGAGGAGTTGGCAGGGACTAGCTATGAGCAT--CCTGACCTGTGGCTCC-TCTCCCAG--ATGTCTCCCTATG-----ACAACCTGCTCCTCTGTCAACCTGT | ||||||||
| **** ** **** * **** * **** *** * * * *** *** ** ********* *** ** ***** * ****** * ***** * * * | |||||||||
| >>>++ +++++++++++++++++++++++ ++++++++++++++++++++++++++++++++++++++++++ ++++++++++++++++ ++++++++ >>>>>>>>>>>>> >>>>>>>>>>> >>>>> | ENSRNOT00000030622 ENSRNOG00000022373 Dennd4b | ||||||||
| >>>++ +++++++++++++++++++++++ ++++++++++++++++++++++++++++++++++++++++++ ++++++++++++++++ ++++++++ >>>>>>>>>>>>> >>>>>>>>>>> >>>>> | ENSRNOT00000049810 ENSRNOG00000022373 Dennd4b | ||||||||
| rat | (((((((.....(((((..(((( ....((...(((((((((((((((((((((.......))).) )))).))...)))))) ))))))). ..))))))))).. ...)))).))) | 0.450 -47.90 | |||||||
| human | ((((( .(((.((.((..(((((.. (((.(((((((((..((((((( (((....))))..))))))))))))))))))...))))).)).)).))).)))))............. | 1.000 -45.70 | |||||||
| mouse | ((((((((.(((.((((..(((...(((. .(((((...((((((((((((((((((....((.....)).) )))).))...)))))) )))))... .)))))))).... ....))))))).))).))).))))) | 0.964 -57.90 | |||||||
| rat | chromosome:2:182513083:182513195:1 | Same_strand|Boundary_coding|ENSRNOT00000030622|ENSRNOG00000022373 ## ENSRNOG00000022373|protein_coding|Dennd4b|DENN/MADD domain containing 4B Gene [Source:MGI Symbol;Acc:MGI:2446201] |
| human | chromosome:1:152180506:152180619:-1 | Same_strand|Boundary_coding|ENST00000361217|ENSG00000198837|protein_coding| |
| mouse | chromosome:3:90074040:90074172:1 | Same_strand|Boundary_coding|ENSMUST00000090888|ENSMUSG00000042404|protein_coding|DENN/MADD domain containing 4B Gene [Source:MGI Symbol;Acc:MGI:2446201] ## {Repeats: trf 0 class=trf} |
block1434071_cand
| absolute | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block1434071_cand 3arm | 18 | 12 | 0 | 0 | 0 | 0 | 0 | 1 | 3 | 0 |
| normalized | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block1434071_cand 3arm | 0.001 | 0.001 | 0 | 0 | 0 | 0 | 0 | 0.000 | 0.000 | 0 |
block1434071 [novel_cloningOK_mirtron]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| no | 0.062 | no | no | 0.55/0.61 | 18/23/0.82 | 0.0 | 0.7 | 29 | 0 | 4 | 0 | 7 | 6 | 3arm | 1 | 0 | 0.11 | 1 | 34 | 4 | na | na |
| reads | miRBase family seed | |||||
| seed | ---------------------------------------------GCUGAGU---------------------- | 34 | novel | |||
| len | cloning frequencies | |||||
| T1S1 | T1S2 | T4S2 | T5S1 | |||
| --------------------------------------------AGCTGAGTGCTGTCCTCCTAG--------- | 21 | 9 | 7 | 1 | 3 | |
| --------------------------------------------AGCTGAGTGCTGTCCTCCTAGAC------- | 23 | 4 | 1 | - | - | |
| --------------------------------------------AGCTGAGTGCTGTCCTCC------------ | 18 | 1 | 3 | - | - | |
| --------------------------------------------AGCTGAGTGCTGTCCTCCTA---------- | 20 | 3 | - | - | - | |
| --------------------------------------------AGCTGAGTGCTGTCCTCCT----------- | 19 | 1 | 1 | - | - | |
| rat | ccgagtggaggggggcaggactgccgggtcctgacagctcctggAGCTGAGTGCTGTCCTCCTAGACtgcaggg | |||||
| ************************************************************************** | ||||||
| ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++>>>>>>>>>>>>>> | ENSRNOT00000036243 ENSRNOG00000014268 Abca2 | |||||
| ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++>>>>>>>>>>>>>> | ENSRNOT00000020339 ENSRNOG00000014268 Abca2 | |||||
| rat | ((.(((..((((((((((.(((..(((.(((.((....))..))).)))))).))))))))))..)))...)). | 0.590 -33.90 | ||||
| rat | chromosome:3:3610927:3611000:1 | Same_strand|Boundary_coding|ENSRNOT00000020339|ENSRNOG00000014268 ## ENSRNOG00000014268|protein_coding|Abca2|ATP-binding cassette sub-family A member 2 (ATP-binding cassette transporter 2) (ATP-binding cassette 2). [Source:UniProtKB/Swiss-Prot;Acc:Q9ESR9] |
| Back to summary page | candidate novel miRNAs: | Page 1 | Jump 10 pages back | Previous page | Page 166 | Next page | Jump 10 pages forward | Page 178 |
©2008 InteRNA Genomics B.V.