candidate novel miRNAs
novel_lenNOK_multiarm_DicerOK_randfoldOK (8 loci)
sblock3211_cand
| absolute | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| sblock3211_cand 5arm | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| sblock3211_cand 3arm | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| normalized | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| sblock3211_cand 5arm | 0.000 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| sblock3211_cand 3arm | 0.000 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |

sblock3211 [novel_lenNOK_multiarm_DicerOK_randfoldOK]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| no | 0.004 | no | no | 0.61/0.61 | 18/18/0.00 | 0.0 0.0 | 0.0 0.0 | 1 1 | 0 0 | 1 1 | 0 0 | 22 9 | 21 24 | 5arm 3arm | 1 1 | nd nd | 0.33 0.11 | 4 1 | 2 | 1 | 3 | 2 |
| Member of family novel169 (seed CCAUGGC): block304777_cand, sblock3211_cand |

| reads | miRBase family seed | ||
| seed | -------------------------------------------------------------------------------------------CCAUGGC------------------- | 1 | novel |
| seed | -----------------------GCAGCCU--------------------------------------------------------------------------------------- | 1 | novel |
| len | cloning frequencies | ||
| T1S1 | |||
| ----------------------AGCAGCCTGCCTGGGATT----------------------------------------------------------------------------- | 18 | 1 | |
| ------------------------------------------------------------------------------------------ACCATGGCAGGAGCACTG--------- | 18 | 1 | |
| rat | tacctggagtcaatgttcagatAGCAGCCTGCCTGGGATTagggttctgcatgacagtggatggctttcaaatacaaatggcaggcctgaACCATGGCAGGAGCACTGacccaggtg | ||
| ********************************************************************************************************************* | |||
| ------------------------------------------------------------------------------------------------------------------------------- | ENSRNOT00000038143 ENSRNOG00000000999 RGD1309707_predicted | ||
| rat | (((((((.((((.((((..........(((((((((..(((((..(((((.((....((((.....))))....))....)))))))))).))).)))))))))).))))))))))) | 0.800 -45.10 |
| rat | chromosome:12:9991361:9991477:-1 | Opposite_strand|Intronic_non-coding|ENSRNOT00000038143|ENSRNOG00000000999 ## Opposite_strand|Boundary_non-coding|ENSRNOT00000031901|ENSRNOG00000000999 ## ENSRNOG00000000999|protein_coding|RGD1309707_predicted|similar to Smad ubiquitination regulatory factor 1 isoform 2 (LOC690516), mRNA [Source:RefSeq_dna;Acc:NM_001109598] |
sblock4307_cand
| absolute | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| sblock4307_cand 5arm | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| sblock4307_cand 3arm | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 |
| normalized | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| sblock4307_cand 5arm | 0 | 0 | 0.000 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| sblock4307_cand 3arm | 0 | 0 | 0 | 0.000 | 0 | 0 | 0 | 0 | 0 | 0 |

sblock4307 [novel_lenNOK_multiarm_DicerOK_randfoldOK]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| no | 0.001 | no | no | 0.50/0.62 | 18/21/0.50 | 0.0 0.0 | 0.0 0.0 | 1 1 | 0 0 | 1 1 | 0 0 | 23 24 | 0 3 | 5arm 3arm | 1 1 | nd nd | 0.10 0.06 | 1 1 | 2 | 2 | 3 | 1 |

| reads | miRBase family seed | |||
| seed | ------------------------GAGCUGC---------------------------------------------------------------- | 1 | novel | |
| seed | ------------------------------------------------------UGGUUCU---------------------------------- | 1 | novel | |
| len | cloning frequencies | |||
| T2S1 | T2S2 | |||
| -----------------------------------------------------TTGGTTCTAGCAGCTCTG------------------------ | 18 | - | 1 | |
| -----------------------AGAGCTGCCTGGAGCCAACTG--------------------------------------------------- | 21 | 1 | - | |
| rat | CTTGCCCGTAGCGTGTATTACACAGAGCTGCCTGGAGCCAACTGACCAGACAGTTGGTTCTAGCAGCTCTGCATCAAGACACTTCCATGGCAAGA | |||
| human | -----------------------CGAGCTGCCTGGAGCC----------------------------TCTGCG---AGGGGCCAGTTCGGCCTCC | |||
| mouse | -----------------------AGAGCTGCCTGGAGCC--------------CCACCTCAGAAGGTGCGGGATATGGGTGCTAG---------- | |||
| *************** * * * * | ||||
| rat | ((((((......((((......((((((((.(((((((((((((......))))))))))))))))))))).......))))......)))))). | 1.000 -48.82 | ||
| human | .((((((.((((..(( ((...) )))..))))..)))).)). | 0.992 -16.30 | ||
| mouse | ..(((.(((((...(( ((((((....))))).)))...)))))))).. | 1.000 -21.20 | ||
| rat | chromosome:14:97788241:97788335:1 | intergenic |
| human | chromosome:6:18385740:18385874:1 | intergenic ## {SimpF: oe = 0.86 0 CpG,rank = 1 -1 FirstEF} |
| mouse | chromosome:1:36373237:36373371:1 | Same_strand|Intronic_non-coding|ENSMUST00000115029|ENSMUSG00000037447|protein_coding|AT rich interactive domain 5A (MRF1-like) Gene [Source:MGI (curated);Acc:Arid5a-002] ## Same_strand|Intronic_coding|ENSMUST00000097778|ENSMUSG00000037447|protein_coding|AT rich interactive domain 5A (MRF1-like) Gene [Source:MGI (curated);Acc:Arid5a-002] |
sblock6133_cand
| absolute | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| sblock6133_cand 5arm | 0 | 0 | 0 | 0 | 0 | 3 | 0 | 0 | 0 | 0 |
| sblock6133_cand 3arm | 0 | 0 | 0 | 0 | 4 | 1 | 0 | 1 | 0 | 0 |
| normalized | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| sblock6133_cand 5arm | 0 | 0 | 0 | 0 | 0 | 0.000 | 0 | 0 | 0 | 0 |
| sblock6133_cand 3arm | 0 | 0 | 0 | 0 | 0.000 | 0.000 | 0 | 0.000 | 0 | 0 |

sblock6133 [novel_lenNOK_multiarm_DicerOK_randfoldOK]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| no | 0.001 | no | no | 0.52/0.60 | 18/23/0.44 | 0.0 0.0 | 2.0 1.2 | 3 6 | 0 0 | 1 3 | 0 0 | 14 17 | 2 3 | 5arm 3arm | 1 1 | nd nd | 0.05 0.05 | 1 1 | 9 | 3 | 1 | 2 |

| reads | miRBase family seed | ||||
| seed | -----------------------------------------------------------CUGUCAA-------------------------------- | 6 | novel | ||
| seed | ---------------GCAGCUG---------------------------------------------------------------------------- | 3 | novel | ||
| len | cloning frequencies | ||||
| T3S1 | T3S2 | T4S2 | |||
| ----------------------------------------------------------ACTGTCAAGCTGCCAGCTGC-------------------- | 20 | 2 | - | - | |
| ----------------------------------------------------------ACTGTCAAGCTGCCAGCTG--------------------- | 19 | 1 | 1 | - | |
| --------------TGCAGCTGGTAGCTTGTG------------------------------------------------------------------ | 18 | - | 1 | - | |
| ----------------------------------------------------------ACTGTCAAGCTGCCAGCT---------------------- | 18 | - | - | 1 | |
| --------------TGCAGCTGGTAGCTTGTGC----------------------------------------------------------------- | 19 | - | 1 | - | |
| ----------------------------------------------------------ACTGTCAAGCTGCCAGCTGCTAT----------------- | 23 | 1 | - | - | |
| --------------TGCAGCTGGTAGCTTGTGCACTG------------------------------------------------------------- | 23 | - | 1 | - | |
| rat | GGTCCCTCTCTACCTGCAGCTGGTAGCTTGTGCACTGACAGTAGAACATGAGAAAGTCACTGTCAAGCTGCCAGCTGCTATTTAAAAGATAGTTACTA | ||||
| mouse | -------------CTGCCACTGGCAGCTTGCAGACTGATGGCAGAACATGAGAAAGTCACTGTCAAGTTGCCAGCTGCTA------------------ | ||||
| **** **** ****** ***** * ************************* ************ | |||||
| rat | (((..((.(((....(((((((((((((((.(((.((((................)))).))))))))))))))))))........))).))..))). | 0.940 -38.49 | |||
| mouse | ..((..((((((((((((((..((((..((.....)).....))))))).)))))))))))..)).. | 0.929 -26.40 | |||
| rat | chromosome:2:175823362:175823459:-1 | intergenic |
| mouse | chromosome:3:83872899:83873036:-1 | intergenic |
sblock6576_cand
| absolute | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| sblock6576_cand 5arm | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 |
| sblock6576_cand 3arm | 0 | 0 | 0 | 0 | 0 | 0.333 | 0 | 0 | 0 | 0 |
| normalized | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| sblock6576_cand 5arm | 0 | 0 | 0 | 0 | 0 | 0.000 | 0 | 0 | 0 | 0 |
| sblock6576_cand 3arm | 0 | 0 | 0 | 0 | 0 | 0.000 | 0 | 0 | 0 | 0 |

sblock6576 [novel_lenNOK_multiarm_DicerOK_randfoldOK]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| no | 0.003 | no | no | 0.56/0.67 | 18/18/0.00 | 0.0 0.0 | 0.0 0.0 | 1 1 | 0 0 | 1 1 | 0 0 | 36 21 | 4 5 | 5arm 3arm | 1 3 | nd nd | 0.28 0.22 | 2 2 | 2 | 1 | 1 | 3 |

| reads | miRBase family seed | ||
| seed | -------------------------------------GGUCCAC--------------------------------------------------------------- | 1 | novel |
| seed | ---------------------------------------------------------------------CAGGAUG------------------------------- | 1 | novel |
| len | cloning frequencies | ||
| T3S2 | |||
| --------------------------------------------------------------------TCAGGATGTGACCCAGGA--------------------- | 18 | 1 | |
| ------------------------------------TGGTCCACAACCTGGGGG----------------------------------------------------- | 18 | 1 | |
| rat | ggggcttctgctccccccacacacccccaaagatgcTGGTCCACAACCTGGGGGaggcacagggcctcTCAGGATGTGACCCAGGAtgtggggacctgcaggctcct | ||
| *********************************************************************************************************** | |||
| rat | (((((..((((...((((((............((.((((..((((.((((..((((((.....)))))))))).))))..)))).))))))))....))))))))). | 0.590 -51.10 |
| rat | chromosome:2:203128363:203128469:1 | intergenic |
sblock7818_cand
| absolute | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| sblock7818_cand 5arm | 0 | 0 | 0 | 1 | 2 | 1 | 0 | 1 | 0 | 0 |
| sblock7818_cand 3arm | 0 | 0 | 3 | 0 | 1 | 0 | 0 | 0 | 0 | 0 |
| normalized | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| sblock7818_cand 5arm | 0 | 0 | 0 | 0.000 | 0.000 | 0.000 | 0 | 0.000 | 0 | 0 |
| sblock7818_cand 3arm | 0 | 0 | 0.000 | 0 | 0.000 | 0 | 0 | 0 | 0 | 0 |

sblock7818 [novel_lenNOK_multiarm_DicerOK_randfoldOK]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| no | 0.001 | no | no | 0.42/0.59 | 18/22/0.44 | 0.0 0.5 0.0 | 0.0 1.0 1.0 | 1 4 4 | 0 0 0 | 1 3 2 | 0 0 0 | 16 27 34 | 16 4 7 | 5arm 5arm 3arm | 1 1 1 | nd nd nd | 0.05 0.05 0.05 | 1 1 1 | 9 | 5 | 3 | 2 |
| Member of family novel230 (seed UCCCCAA): block853285_cand, sblock7818_cand |

| reads | miRBase family seed | ||||||
| seed | -----------------------------------------------------------------------------------------------AAGCUUA------------------------------------------------ | 4 | novel | ||||
| seed | -----------------------------CCCCAAC------------------------------------------------------------------------------------------------------------------ | 2 | novel | ||||
| seed | ----------------------------UCCCCAA------------------------------------------------------------------------------------------------------------------- | 2 | novel | ||||
| seed | -----------------UGCCCAA------------------------------------------------------------------------------------------------------------------------------ | 1 | novel | ||||
| len | cloning frequencies | ||||||
| T2S1 | T2S2 | T3S1 | T3S2 | T4S2 | |||
| ----------------------------------------------------------------------------------------------CAAGCTTAAAGGTTGAGGA------------------------------------- | 19 | 2 | - | - | - | - | |
| ---------------------------GTCCCCAACCTTTAAGCTT-------------------------------------------------------------------------------------------------------- | 19 | - | - | 1 | 1 | - | |
| ----------------------------TCCCCAACCTTTAAGCTT-------------------------------------------------------------------------------------------------------- | 18 | - | - | 1 | - | - | |
| ----------------ATGCCCAAGGAGTCCCCAACCT---------------------------------------------------------------------------------------------------------------- | 22 | - | - | - | - | 1 | |
| ----------------------------TCCCCAACCTTTAAGCTTGTGC---------------------------------------------------------------------------------------------------- | 22 | - | 1 | - | - | - | |
| ----------------------------------------------------------------------------------------------CAAGCTTAAAGGTTGAGGACTC---------------------------------- | 22 | 1 | - | - | - | - | |
| ----------------------------------------------------------------------------------------------CAAGCTTAAAGGTTGAGGAC------------------------------------ | 20 | - | - | 1 | - | - | |
| rat | GCTAGGAACAGTCTGGATGCCCAAGGAGTCCCCAACCTTTAAGCTTGTGCTGAGCCTCTGGG------------------------------CACAAGCTTAAAGGTTGAGGACTCCTTGGGCAATCTAAATACATTTGTTCACCCTAGG | ||||||
| mouse | -----------------TGCCCAAGGAGGCCCCAGTCTTTAAGCTTCTGCTGAGCCTCTGGGTCTTGCTATTGAGAAAATCCACAGGCTCAACACAAGCTTAAAGGTTGGGGACTCCTTGGGCA-------------------------- | ||||||
| *********** ***** ********** *************** ***************** ************** | |||||||
| ------------------------------------------------------------------- --------------------------------------------------------------- | ENSRNOT00000024352 ENSRNOG00000017983 Ubadc1 | ||||||
| rat | .((((((((((..((((((((((((((((((.(((((((((((((((((((.((...)).)) ))))))))))))))))).)))))))))))))).)))).......)))))...))))). | 0.930 -74.00 | |||||
| mouse | .((((((((((.(((((..((((((((((.((.(((((((.((((((((......))))...)))).))))))).)).))))))))))..))))).)))))))))). | 1.000 -69.70 | |||||
| rat | chromosome:3:4200057:4200176:1 | Opposite_strand|Intronic_coding|ENSRNOT00000024352|ENSRNOG00000017983 ## ENSRNOG00000017983|protein_coding|Ubadc1|Ubiquitin-associated domain-containing protein 1 (UBA domain- containing protein 1) (E3 ubiquitin-protein ligase subunit KPC2) (Kip1 ubiquitination-promoting complex protein 2). [Source:UniProtKB/Swiss-Prot;Acc:Q5XIR9] |
| mouse | chromosome:2:25875691:25875797:1 | Opposite_strand|Intronic_coding|ENSMUST00000114161|ENSMUSG00000036352|protein_coding|ubiquitin associated domain containing 1 Gene [Source:MGI (curated);Acc:Ubac1-001] |
sblock8126_cand
| absolute | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| sblock8126_cand 5arm | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| sblock8126_cand 3arm | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| normalized | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| sblock8126_cand 5arm | 0.000 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| sblock8126_cand 3arm | 0.000 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |

sblock8126 [novel_lenNOK_multiarm_DicerOK_randfoldOK]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| no | 0.001 | no | no | 0.65/0.68 | 19/20/0.50 | 0.0 0.0 | 0.0 0.0 | 1 1 | 0 0 | 1 1 | 0 0 | 16 8 | 2 3 | 5arm 3arm | 1 1 | nd nd | 0.26 0.15 | 2 1 | 2 | 1 | 1 | 3 |

| reads | miRBase family seed | ||
| seed | -----------------------------------------------CCUGGAG-------------------- | 1 | novel |
| seed | -----------------GCUCCAG-------------------------------------------------- | 1 | novel |
| len | cloning frequencies | ||
| T1S1 | |||
| ----------------------------------------------TCCTGGAGCGCTTAGCCGAG-------- | 20 | 1 | |
| ----------------GGCTCCAGCACTCCAGAGC--------------------------------------- | 19 | 1 | |
| rat | agtatgaacctcacagGGCTCCAGCACTCCAGAGCtttcctttgagTCCTGGAGCGCTTAGCCGAGgtggagac | ||
| ************************************************************************** | |||
| ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ | ENSRNOT00000019215 ENSRNOG00000014230 Mtap1a | ||
| rat | .((....(((((....((((..(((.((((((..(((......)))..)))))).))).)))))))))....)) | 1.000 -31.10 |
| rat | chromosome:3:108096111:108096184:1 | Same_strand|Boundary_non-coding|ENSRNOT00000019320|ENSRNOG00000014230 ## Same_strand|Intronic_coding|ENSRNOT00000019215|ENSRNOG00000014230 ## ENSRNOG00000014230|protein_coding|Mtap1a|Microtubule-associated protein 1A (MAP 1A) [Contains: MAP1 light chain LC2]. [Source:UniProtKB/Swiss-Prot;Acc:P34926] |
sblock8483_cand
| absolute | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| sblock8483_cand 5arm | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| sblock8483_cand 3arm | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 |
| normalized | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| sblock8483_cand 5arm | 0.000 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| sblock8483_cand 3arm | 0 | 0 | 0 | 0 | 0 | 0 | 0.000 | 0 | 0 | 0 |

sblock8483 [novel_lenNOK_multiarm_DicerOK_randfoldOK]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| no | 0.003 | no | no | 0.53/0.57 | 19/23/0.50 | 0.0 0.0 | 0.0 0.0 | 1 1 | 0 0 | 1 1 | 0 0 | 31 24 | 8 8 | 5arm 3arm | 1 1 | nd nd | 0.21 0.35 | 3 3 | 2 | 2 | 1 | 2 |

| reads | miRBase family seed | |||
| seed | -----------------------------------------------------------------------AACAGAG--------------------------------------- | 1 | novel | |
| seed | --------------------------------CCAGAUG------------------------------------------------------------------------------ | 1 | novel | |
| len | cloning frequencies | |||
| T1S1 | T4S1 | |||
| -------------------------------CCCAGATGGGCTCATATCT------------------------------------------------------------------- | 19 | 1 | - | |
| ----------------------------------------------------------------------GAACAGAGACCAGGTCTGGAGGA------------------------ | 23 | - | 1 | |
| rat | GCTGTGCCAGGCCCCTCTGCCACAAGCCCTCCCCAGATGGGCTCATATCTCTTATTCCCAATGGAAGTGAGAACAGAGACCAGGTCTGGAGGAACCAGAGGGACCATGGTGACCGTG | |||
| mouse | -------------------------------CCCAGATGGGCTCAGATCTCTTGTTCACAATGGAAGTGAGACCAGAGACCAGGTCTGGAG-------------------------- | |||
| ************** ******* *** ************** ****************** | ||||
| rat | ((.((((((((.(((((((..........(((((((((.(((((...((((...((((....))))..))))...))).))..)))))).)))..))))))).)).)))).)).)). | 0.670 -46.80 | ||
| mouse | .((((((.(((((...((((...(((.....)))...))))...))).))..)))))).. | 0.994 -20.80 | ||
| rat | chromosome:4:118404485:118404601:-1 | intergenic |
| mouse | chromosome:6:84193327:84193483:-1 | intergenic |
novel_lenNOK_cloningOK_mirtron_randfoldOK (5 loci)
block448483_cand
| absolute | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block448483_cand 3arm | 6 | 3 | 0 | 0 | 5 | 1 | 3 | 1 | 1 | 1 |
| normalized | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block448483_cand 3arm | 0.000 | 0.000 | 0 | 0 | 0.000 | 0.000 | 0.000 | 0.000 | 0.000 | 0.000 |

block448483 [novel_lenNOK_cloningOK_mirtron_randfoldOK]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| no | 0.001 | no | no | 0.67/0.78 | 18/22/0.62 | 0.7 | 1.6 | 21 | 0 | 8 | 0 | 8 | 5 | 3arm | 1 | 0 | 0.28 | 2 | 21 | 8 | na | na |
| Member of family novel199 (seed CUCCCUG): block448483_cand, block796693_cand |

| reads | miRBase family seed | |||||||||
| seed | ---------------------------------------------------UCCCUGU----------------------- | 11 | novel | |||||||
| seed | ----------------------------------------------------CCCUGUC---------------------- | 8 | miR-339 | |||||||
| seed | --------------------------------------------------CUCCCUG------------------------ | 2 | novel | |||||||
| len | cloning frequencies | |||||||||
| T1S1 | T1S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 | |||
| --------------------------------------------------CTCCCTGTCCACCGCCCC------------- | 18 | 1 | 2 | - | 1 | - | - | - | - | |
| ---------------------------------------------------TCCCTGTCCACCGCCCCTACA--------- | 21 | - | 1 | 2 | - | - | - | 1 | - | |
| ---------------------------------------------------TCCCTGTCCACCGCCCCT------------ | 18 | 3 | - | - | - | - | - | - | - | |
| --------------------------------------------------CTCCCTGTCCACCGCCCCTAC---------- | 21 | 1 | - | 2 | - | - | - | - | - | |
| --------------------------------------------------CTCCCTGTCCACCGCCCCTA----------- | 20 | - | - | - | - | 2 | - | - | - | |
| -------------------------------------------------CCTCCCTGTCCACCGCCCCTAC---------- | 22 | 1 | - | - | - | - | - | - | - | |
| --------------------------------------------------CTCCCTGTCCACCGCCCCTACA--------- | 22 | - | - | 1 | - | - | - | - | - | |
| -------------------------------------------------CCTCCCTGTCCACCGCCCCTA----------- | 21 | - | - | - | - | 1 | - | - | - | |
| --------------------------------------------------CTCCCTGTCCACCGCCCCT------------ | 19 | - | - | - | - | - | - | - | 1 | |
| ---------------------------------------------------TCCCTGTCCACCGCCCCTACAG-------- | 22 | - | - | - | - | - | 1 | - | - | |
| rat | gcagggacatttggggctgtgggcggcctctgggttcatattctgacccCCTCCCTGTCCACCGCCCCTACAGgctctgcc | |||||||||
| ********************************************************************************* | ||||||||||
| ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++>>>>>>>>>>>>> | ENSRNOT00000022706 ENSRNOG00000016777 R3hcc1_predicted | |||||||||
| rat | ((((((......(((((.((((((((.....(((((........))))).....)))))))).)))))......)))))). | 1.000 -41.10 | ||||||||
| rat | chromosome:15:50079598:50079678:-1 | Same_strand|Intronic_coding|ENSRNOT00000022706|ENSRNOG00000016777 ## ENSRNOG00000016777|protein_coding|R3hcc1_predicted| |
block668798_cand
| absolute | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block668798_cand 5arm | 2 | 2 | 2 | 2 | 0 | 0 | 3 | 0 | 3 | 2 |
| normalized | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block668798_cand 5arm | 0.000 | 0.000 | 0.000 | 0.000 | 0 | 0 | 0.000 | 0 | 0.000 | 0.000 |

block668798 [novel_lenNOK_cloningOK_mirtron_randfoldOK]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| no | 0.003 | no | no | 0.44/0.47 | 18/19/0.00 | 0.1 | 0.1 | 16 | 0 | 7 | 0 | 22 | 17 | 5arm | 1 | 4 | 0.26 | 3 | 16 | 7 | na | na |

| reads | miRBase family seed | ||||||||
| seed | -----------------------CUGUCAU--------------------------------------------------------------------------------------- | 15 | novel | ||||||
| seed | ------------------------UGUCAUU-------------------------------------------------------------------------------------- | 1 | novel | ||||||
| len | cloning frequencies | ||||||||
| T1S1 | T1S2 | T2S1 | T2S2 | T4S1 | T5S1 | T5S2 | |||
| ----------------------CCTGTCATTTCCAGGATA----------------------------------------------------------------------------- | 18 | 2 | 2 | 2 | 2 | 2 | 3 | 1 | |
| ----------------------CCTGTCATTTCCAGGATAC---------------------------------------------------------------------------- | 19 | - | - | - | - | 1 | - | - | |
| -----------------------CTGTCATTTCCAGGATAC---------------------------------------------------------------------------- | 18 | - | - | - | - | - | - | 1 | |
| rat | ttgcttttcttagtaataattgCCTGTCATTTCCAGGATACagctggtcaagaaaggttcagaacattaactcccagctattatagaggtgcacagggagttatattaggtaagtaa | ||||||||
| ********************************************************************************************************************* | |||||||||
| +++++++++++++++++++++++++++++++++++++++++>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>+++++++++++++ | ENSRNOT00000025828 ENSRNOG00000018972 Rab18 | ||||||||
| rat | .(((((..((((((.((((((.(((((((((((...(((..((((((.........((.....))........)))))))))...)))))).))))).)))))))))))).))))). | 0.980 -34.53 | |||||||
| rat | chromosome:17:63522941:63523057:1 | Same_strand|Boundary_coding|ENSRNOT00000025828|ENSRNOG00000018972 ## ENSRNOG00000018972|protein_coding|Rab18|Ras-related protein Rab-18. [Source:UniProtKB/Swiss-Prot;Acc:Q5EB77] |
block749566_cand
| absolute | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block749566_cand 3arm | 0 | 0 | 0 | 0 | 10 | 0 | 2 | 0 | 3 | 0 |
| normalized | T1S1 | T1S2 | T2S1 | T2S2 | T3S1 | T3S2 | T4S1 | T4S2 | T5S1 | T5S2 |
| block749566_cand 3arm | 0 | 0 | 0 | 0 | 0.000 | 0 | 0.000 | 0 | 0.000 | 0 |

block749566 [novel_lenNOK_cloningOK_mirtron_randfoldOK]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| no | 0.002 | no | no | 0.39/0.48 | 18/24/0.60 | 0.7 | 3.3 | 15 | 0 | 3 | 0 | 22 | 5 | 3arm | 1 | 0 | 0.13 | 2 | 15 | 3 | na | na |

| reads | miRBase family seed | ||||
| seed | ---------------------------------------------------------------------------UUGUGUU-------------------------------------- | 11 | novel | ||
| seed | --------------------------------------------------------------------------CUUGUGU--------------------------------------- | 4 | novel | ||
| len | cloning frequencies | ||||
| T3S1 | T4S1 | T5S1 | |||
| --------------------------------------------------------------------------CTTGTGTTTCTCTTCCTTCCCA------------------------ | 22 | 2 | 1 | - | |
| -------------------------------------------------------------------------ACTTGTGTTTCTCTTCCT----------------------------- | 18 | 1 | - | 2 | |
| --------------------------------------------------------------------------CTTGTGTTTCTCTTCCTTCCC------------------------- | 21 | 2 | - | 1 | |
| --------------------------------------------------------------------------CTTGTGTTTCTCTTCCTTC--------------------------- | 19 | 2 | - | - | |
| --------------------------------------------------------------------------CTTGTGTTTCTCTTCCTTCCCAGT---------------------- | 24 | - | 1 | - | |
| -------------------------------------------------------------------------ACTTGTGTTTCTCTTCCTTCCCA------------------------ | 23 | 1 | - | - | |
| --------------------------------------------------------------------------CTTGTGTTTCTCTTCCTT---------------------------- | 18 | 1 | - | - | |
| --------------------------------------------------------------------------CTTGTGTTTCTCTTCCTTCCCAG----------------------- | 23 | 1 | - | - | |
| rat | gggcttgactgctctacagttctaagagattgggaggaggtggggacaacaaactgataacccagatgtatcaACTTGTGTTTCTCTTCCTTCCCAGTgttcttgtgaagacagaagcca | ||||
| ************************************************************************************************************************ | |||||
| ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++>>>>>>>>>>>>>>>>>>>>>>>>>>>> | ENSRNOT00000025344 ENSRNOG00000018735 Cd74 | ||||
| rat | .(((((..(((.(((.((....((((((((((((((((((.((..((.((((..(((((.........)))))..))))))..)))))))).)))))).)))))))).))))))))))). | 0.910 -43.20 | |||
| rat | chromosome:18:56765150:56765269:1 | Same_strand|Boundary_non-coding|ENSRNOT00000025354|ENSRNOG00000018735 ## Same_strand|Boundary_coding|ENSRNOT00000025344|ENSRNOG00000018735 ## ENSRNOG00000018735|protein_coding|Cd74|H-2 class II histocompatibility antigen gamma chain (MHC class II- associated invariant chain) (Ia antigen-associated invariant chain) (Ii) (CD74 antigen). [Source:UniProtKB/Swiss-Prot;Acc:P10247] |
| Back to summary page | candidate novel miRNAs: | Page 1 | Jump 10 pages back | Previous page | Page 171 | Next page | Page 178 |
