Small RNA from different tissues of two rat strains.

miR-Intess™

miR classification

miR expression

block1317251_cand

block1317251_cand

Cloning frequencies
absolute	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block1317251_cand 3arm	0	0	0	0	1	0	0	0	0	0
normalized	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block1317251_cand 3arm	0	0	0	0	0.000	0	0	0	0	0

block1317251_cand relative cloning frequencies

block1317251 [novel_randfoldOK]

Hairpin parameters
miRNA	randfold	RNA	rep	GC min/max	len min/max/mir_range	5'var	3'var	reads	reads edited	libs	libs edited	base distance	loop distance	position	locations	exon distance	unpaired	max bulge	total reads	total libs	dicer	drosha
no	0.005	no	no	0.50/0.50	20/20/1.00	0.0	0.0	1	0	1	0	6	10	3arm	1	nd	0.30	2	1	1	na	na

Families
Member of family novel23 (seed CUCAGCA): sblock706_novel, block29776_cand, block1317251_cand, block97555_cand

block1317251 hairpin

		reads	miRBase family seed
seed	---------------------------------------------------CUCAGCA------------------	1	novel
		len	cloning frequencies
			T3S1
	--------------------------------------------------GCTCAGCAATTCACGAGTTC------	20	1
rat	CACCAGACTGTCTGTCCCTGAGATCCAGAGGAGACAGTTGCTGCCTCTCTGCTCAGCAATTCACGAGTTCTGGTGA
mouse	-----GAGTCTCTGTCCCTGAGACCCAGAGGGGACAGTGGTTACCTCTCTGCTCAGCAATTCCTGGACTC------
	** * *********** *** **** * * ******************* * **
rat	(((((((((((..((..(((((...((((.(((.(((...))).))))))))))))..))..)).))).)))))).	0.880 -27.40
mouse	((((((..((..(((((...((((((((((....))..)))))))))))))..))....))))))	0.998 -23.30

rat	chromosome:2:191879805:191879880:1	intergenic
mouse	chromosome:3:96904009:96904124:1	intergenic

©2008 InteRNA Genomics B.V.