Small RNA from different tissues of two rat strains.

miR-Intess™

miR classification

miR expression

block15863_cand

block15863_cand

Cloning frequencies
absolute	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block15863_cand 3arm	0	1	0	0	0	0	0	0	0	0
normalized	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block15863_cand 3arm	0	0.000	0	0	0	0	0	0	0	0

block15863_cand relative cloning frequencies

block15863 [novel_randfoldOK]

Hairpin parameters
miRNA	randfold	RNA	rep	GC min/max	len min/max/mir_range	5'var	3'var	reads	reads edited	libs	libs edited	base distance	loop distance	position	locations	exon distance	unpaired	max bulge	total reads	total libs	dicer	drosha
no	0.004	no	no	0.65/0.65	20/20/1.00	0.0	0.0	1	0	1	0	12	14	3arm	1	nd	0.05	1	1	1	na	na

Families
Member of family novel164 (seed GGCCCUG): block15863_cand, block1439122_cand

block15863 hairpin

		reads	miRBase family seed
seed	----------------------------------------------------------------------------GGCCCUG------------------------	1	novel
		len	cloning frequencies
			T1S2
	---------------------------------------------------------------------------AGGCCCTGAGGACCCTGAGT------------	20	1
rat	GCAGAAAAAAACGCACAGGGTTATGCAGCTGTTCTCGGGGCTTCCAGAGAGTCAGTTAACGGCTACCTCTATAACAGGCCCTGAGGACCCTGAGTGTCAGAGCTGCG
mouse	------------GCACAGGGTTTTGCAGCTGTTCTCGGGGCTTCCGGGGAGTCCGTTAACGGCTACCTCTCTAACAGGCCCTGAGAACCCTGAG------------G
	******** ******************** * *** ************ ********** ****** *
rat	((((......((((.(((((((...........((((((((((....((((..(((.....)))..)))).....))))))))))))))))).)))).....)))).	0.670 -43.90
mouse	...((((((...........(((((((((((..((((((.(((....)))....))))))...))))))))))))))))).. .	0.798 -36.90

rat	chromosome:10:36521342:36521448:-1	intergenic
mouse	chromosome:11:50757190:50757336:-1	Same_strand\|Boundary_non-coding\|ENSMUST00000101256\|ENSMUSG00000072983\|protein_coding\|RIKEN cDNA 4933414I15 gene Gene [Source:MGI Symbol;Acc:MGI:1918374]

©2008 InteRNA Genomics B.V.