Small RNA from different tissues of two rat strains.

miR-Intess™

miR classification

miR expression

block316525_cand

block316525_cand

Cloning frequencies
absolute	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block316525_cand 3arm	0	0	0	0	0	0	0	0	2	0
normalized	T1S1	T1S2	T2S1	T2S2	T3S1	T3S2	T4S1	T4S2	T5S1	T5S2
block316525_cand 3arm	0	0	0	0	0	0	0	0	0.000	0

block316525_cand relative cloning frequencies

block316525 [novel_randfoldOK]

Hairpin parameters
miRNA	randfold	RNA	rep	GC min/max	len min/max/mir_range	5'var	3'var	reads	reads edited	libs	libs edited	base distance	loop distance	position	locations	exon distance	unpaired	max bulge	total reads	total libs	dicer	drosha
no	0.008	no	no	0.41/0.41	22/22/1.00	0.0	0.0	2	0	1	0	28	1	3arm	1	nd	0.23	3	2	1	na	na

Families
Member of family novel132 (seed CUCACAG): block1763008_cand, block316525_cand

block316525 hairpin

		reads	miRBase family seed
seed	--------------------------------------------------------------------CUCACAG------------------------------------------	2	novel
		len	cloning frequencies
			T5S1
	-------------------------------------------------------------------TCTCACAGCCAAAGCATATTGA----------------------------	22	2
rat	AGCAAATCCACAGCACAGTTCTGAGAGGATAGGAATGCTTTGTGAAAGCAAAGAGATGAGGTAAAAATCTCACAGCCAAAGCATATTGATCTCCAGAAAGAAACTATGAGATAGGTT
mouse	---------------------TTGGAGGACAGGAATGCTTTGTGAAGGCAAAGAGGTGAGGT-AAAATCTCACAGCCGAAGCATGCTGGTCTCCAG---------------------
	* *** ************ **** ** ********** ** *******
rat	(((..(((((.((.....(((((.((((.(((..((((((((.....((...(((((.........)))))...)))))))))).))).))))))))).....)).)).)))..)))	0.410 -28.40
mouse	.(((((..(((..(((((((.....(((......((((((( ...))))))).)))))))))).)))..))))).	0.938 -29.50

rat	chromosome:13:73632485:73632601:1	intergenic
mouse	chromosome:1:160274230:160274303:1	Opposite_strand\|Intronic_non-coding\|ENSMUST00000004133\|ENSMUSG00000004031\|protein_coding\|RIKEN cDNA 6430517E21 gene Gene [Source:MGI Symbol;Acc:MGI:2443333]

©2008 InteRNA Genomics B.V.